Incidental Mutation 'R4688:Sh2b3'
ID353845
Institutional Source Beutler Lab
Gene Symbol Sh2b3
Ensembl Gene ENSMUSG00000042594
Gene NameSH2B adaptor protein 3
SynonymsLnk
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R4688 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121815488-121837646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121818634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 318 (D318V)
Ref Sequence ENSEMBL: ENSMUSP00000113808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040308] [ENSMUST00000051950] [ENSMUST00000086310] [ENSMUST00000118580] [ENSMUST00000122426] [ENSMUST00000136960] [ENSMUST00000160220] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327] [ENSMUST00000197892]
Predicted Effect probably benign
Transcript: ENSMUST00000040308
AA Change: D328V

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041611
Gene: ENSMUSG00000042594
AA Change: D328V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 23 76 1.1e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086310
AA Change: D328V

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594
AA Change: D328V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118580
AA Change: D318V

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113808
Gene: ENSMUSG00000042594
AA Change: D318V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 4.1e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 324 409 3.53e-19 SMART
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122426
AA Change: D328V

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113926
Gene: ENSMUSG00000042594
AA Change: D328V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136960
AA Change: I355F
SMART Domains Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594
AA Change: I355F

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2.4e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect probably benign
Transcript: ENSMUST00000160220
SMART Domains Protein: ENSMUSP00000124059
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183860
Predicted Effect probably benign
Transcript: ENSMUST00000197892
SMART Domains Protein: ENSMUSP00000142666
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 6.3e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
Blast:PH 168 250 3e-53 BLAST
PDB:1V5M|A 171 250 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198161
Predicted Effect probably benign
Transcript: ENSMUST00000199864
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SH2B family of adapter proteins that play an important role in T cell receptor signaling. This gene is preferentially expressed in hematopoietic stem cells, hematopoietic progenitors, pre and immature B cells, as well as megakaryocytes and mastocytes. In hematopoietic stem cells, the encoded protein is a key regulator of self-renewal, proliferation and apoptosis. Mice lacking the encoded protein exhibit pre and immature B cell expansion in spleen and the bone marrow. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe perturbations in hematopoiesis, splenomegaly, and abnormal lymphoid and myeloid homeostasis. Mice homozygous for a different knock-out allele display altered mobility of hematopoietic stem/progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Sh2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02283:Sh2b3 APN 5 121818655 missense probably benign 0.09
IGL02328:Sh2b3 APN 5 121817859 missense probably benign 0.00
PIT4449001:Sh2b3 UTSW 5 121828679 missense possibly damaging 0.95
R0164:Sh2b3 UTSW 5 121829037 missense probably damaging 0.97
R0164:Sh2b3 UTSW 5 121829037 missense probably damaging 0.97
R2898:Sh2b3 UTSW 5 121829048 start codon destroyed probably null 0.93
R4374:Sh2b3 UTSW 5 121828486 unclassified probably benign
R4822:Sh2b3 UTSW 5 121828555 unclassified probably benign
R5743:Sh2b3 UTSW 5 121828457 missense probably damaging 1.00
R5888:Sh2b3 UTSW 5 121829021 missense possibly damaging 0.73
R6130:Sh2b3 UTSW 5 121815563 unclassified probably null
R6167:Sh2b3 UTSW 5 121828355 intron probably null
R6413:Sh2b3 UTSW 5 121828923 missense probably damaging 1.00
R7499:Sh2b3 UTSW 5 121818473 missense probably damaging 0.97
R7672:Sh2b3 UTSW 5 121818759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAAGATCAGCCTGCTGCC -3'
(R):5'- CTCTTTCCTTAGCGGCAGAG -3'

Sequencing Primer
(F):5'- TGCCCAGGCTGCATTTG -3'
(R):5'- AGCCTGGCCCAGCTAGATC -3'
Posted On2015-10-21