Incidental Mutation 'R4688:Fam98c'
ID353859
Institutional Source Beutler Lab
Gene Symbol Fam98c
Ensembl Gene ENSMUSG00000030590
Gene Namefamily with sequence similarity 98, member C
Synonyms
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4688 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29152510-29156234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29155241 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 147 (E147K)
Ref Sequence ENSEMBL: ENSMUSP00000131477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000048923] [ENSMUST00000094617] [ENSMUST00000123416] [ENSMUST00000134176] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160396] [ENSMUST00000161522] [ENSMUST00000164589] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
Predicted Effect probably benign
Transcript: ENSMUST00000032811
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094617
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123416
AA Change: E58K

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122992
Gene: ENSMUSG00000030590
AA Change: E58K

DomainStartEndE-ValueType
Pfam:DUF2465 6 125 8.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123545
Predicted Effect probably benign
Transcript: ENSMUST00000134176
SMART Domains Protein: ENSMUSP00000120165
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 1 125 5.9e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136256
AA Change: E147K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118932
Gene: ENSMUSG00000030590
AA Change: E147K

DomainStartEndE-ValueType
Pfam:DUF2465 6 273 7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138084
Predicted Effect unknown
Transcript: ENSMUST00000144795
AA Change: E143K
SMART Domains Protein: ENSMUSP00000121796
Gene: ENSMUSG00000030590
AA Change: E143K

DomainStartEndE-ValueType
Pfam:DUF2465 5 175 1.7e-30 PFAM
Pfam:DUF2465 172 213 1.3e-14 PFAM
Pfam:DUF2465 211 242 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150431
Predicted Effect unknown
Transcript: ENSMUST00000153251
AA Change: E54K
SMART Domains Protein: ENSMUSP00000117500
Gene: ENSMUSG00000030590
AA Change: E54K

DomainStartEndE-ValueType
Pfam:DUF2465 1 114 1.9e-22 PFAM
Pfam:DUF2465 111 196 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159351
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159898
Predicted Effect probably benign
Transcript: ENSMUST00000159975
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160396
Predicted Effect probably benign
Transcript: ENSMUST00000161522
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164589
AA Change: E147K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131477
Gene: ENSMUSG00000030590
AA Change: E147K

DomainStartEndE-ValueType
Pfam:DUF2465 8 327 3.8e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184073
Predicted Effect probably benign
Transcript: ENSMUST00000203070
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203380
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204194
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204845
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205027
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205672
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Fam98c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Fam98c APN 7 29152853 unclassified probably benign
IGL02603:Fam98c APN 7 29154448 missense probably damaging 1.00
IGL02638:Fam98c APN 7 29152762 missense probably damaging 1.00
R0147:Fam98c UTSW 7 29152721 nonsense probably null
R1248:Fam98c UTSW 7 29152840 missense probably damaging 1.00
R4627:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4628:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4629:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R5247:Fam98c UTSW 7 29155701 missense possibly damaging 0.84
R6254:Fam98c UTSW 7 29154517 missense probably damaging 1.00
R6354:Fam98c UTSW 7 29152847 missense probably damaging 1.00
R6388:Fam98c UTSW 7 29155303 missense probably damaging 0.98
R6433:Fam98c UTSW 7 29156128 critical splice donor site probably null
R7058:Fam98c UTSW 7 29155883 critical splice donor site probably null
R7626:Fam98c UTSW 7 29152823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACGAATGGCCACTGTCG -3'
(R):5'- TGGTTCTGAAGTGGACCCAC -3'

Sequencing Primer
(F):5'- AATGGCCACTGTCGATGGGTC -3'
(R):5'- ACATCCCCCATTGTCGGTGG -3'
Posted On2015-10-21