Mutagenetix > Incidental Mutation

Incidental Mutation 'R4688:Nrp1'

353872

Institutional Source

Beutler Lab

Gene Symbol

Nrp1

Ensembl Gene

ENSMUSG00000025810

Gene Name

neuropilin 1

Synonyms

Neuropilin-1, NP-1, NPN-1, Npn1

MMRRC Submission

041939-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4688 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128358604-128503363 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128502566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 842 (N842D)

Ref Sequence

ENSEMBL: ENSMUSP00000026917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026917]

AlphaFold

P97333

PDB Structure

Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000026917
AA Change: N842D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: N842D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CUB	27	141	1.44e-43	SMART
CUB	147	265	9.19e-42	SMART
FA58C	274	424	5.21e-44	SMART
FA58C	430	583	4.15e-20	SMART
low complexity region	587	599	N/A	INTRINSIC
MAM	645	811	4.94e-69	SMART
Pfam:DUF3481	837	920	3.5e-31	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,449	S530P	probably benign	Het
1700003E16Rik	A	G	6: 83,162,698	N535S	probably damaging	Het
2810403A07Rik	T	A	3: 88,686,517	M71K	probably damaging	Het
9930021J03Rik	A	G	19: 29,717,101	I1664T	probably benign	Het
Abcc12	T	C	8: 86,548,694	S452G	possibly damaging	Het
Acacb	C	A	5: 114,204,763	Q897K	probably benign	Het
Acot3	C	A	12: 84,053,917	R145S	probably damaging	Het
AI314180	A	G	4: 58,840,757	V667A	probably damaging	Het
Ankrd54	A	T	15: 79,054,582	Y247N	probably damaging	Het
Arl11	G	A	14: 61,311,097	V119I	probably benign	Het
Atxn7	T	A	14: 14,089,288	M268K	probably benign	Het
Bms1	G	A	6: 118,392,706	R934C	probably damaging	Het
Ccdc129	G	A	6: 55,967,147		probably null	Het
Chrnb3	T	C	8: 27,394,119	S295P	probably damaging	Het
Cic	TCCCCC	TCCCCCCC	7: 25,291,670		probably null	Het
Cnr1	A	T	4: 33,944,571	I320F	probably benign	Het
Cntn4	C	T	6: 106,437,949	P147L	probably damaging	Het
Col24a1	G	A	3: 145,314,383	V172I	probably benign	Het
Col9a3	A	G	2: 180,607,631	D262G	probably damaging	Het
Csrnp2	A	G	15: 100,482,360	V350A	probably damaging	Het
D630045J12Rik	A	G	6: 38,196,657	V192A	possibly damaging	Het
Deptor	A	G	15: 55,208,781	M219V	probably benign	Het
Dmrtb1	A	T	4: 107,684,050	L38Q	probably damaging	Het
Dvl2	G	A	11: 70,007,518	R367Q	possibly damaging	Het
Dync1h1	T	G	12: 110,655,528	I3435S	probably damaging	Het
Eif2b3	A	G	4: 117,058,849	N218D	probably benign	Het
Epha2	A	G	4: 141,318,981	D497G	probably benign	Het
Epha7	G	T	4: 28,821,367	L177F	probably damaging	Het
Fam214b	A	G	4: 43,034,663	F352S	probably damaging	Het
Fam98c	C	T	7: 29,155,241	E147K	probably damaging	Het
Fbxo17	A	G	7: 28,732,554	T19A	probably benign	Het
Fbxo47	A	G	11: 97,856,223	F339S	probably damaging	Het
Frmd4a	G	T	2: 4,537,311	V234L	possibly damaging	Het
Gal3st2	A	G	1: 93,872,523	D32G	probably damaging	Het
Gpr135	T	C	12: 72,070,946	T16A	probably benign	Het
Gpr160	A	T	3: 30,896,686	R302S	probably benign	Het
Hrh2	C	A	13: 54,214,801	N265K	probably benign	Het
Htatip2	C	A	7: 49,773,423	A242E	probably damaging	Het
Igfbp7	T	C	5: 77,407,635	Y127C	probably damaging	Het
Igkv16-104	A	G	6: 68,425,894	Q57R	possibly damaging	Het
Ino80c	A	G	18: 24,108,846	S161P	probably damaging	Het
Kcnc1	A	G	7: 46,397,835	D53G	probably benign	Het
Lce1h	G	T	3: 92,763,567	R93S	unknown	Het
Lce1k	T	C	3: 92,806,644	S78G	unknown	Het
Lhcgr	T	A	17: 88,765,152	I156F	probably damaging	Het
Lpl	T	C	8: 68,899,425	Y343H	probably damaging	Het
Lrp6	G	T	6: 134,479,743	R853S	probably damaging	Het
Lrrc7	A	G	3: 158,148,605	V1322A	probably damaging	Het
Lrrc74a	C	T	12: 86,737,698	Q67*	probably null	Het
Megf6	A	T	4: 154,253,814	D447V	probably damaging	Het
Mep1a	T	C	17: 43,482,248	D355G	possibly damaging	Het
Ncoa1	T	C	12: 4,315,781	D95G	probably benign	Het
Npepl1	A	T	2: 174,114,442	I139F	possibly damaging	Het
Nrcam	T	C	12: 44,547,237	S262P	probably benign	Het
Olfml3	A	G	3: 103,732,181		probably benign	Het
Olfr1375	A	G	11: 51,048,988	R294G	probably damaging	Het
Olfr1505	A	T	19: 13,919,241	T74S	probably benign	Het
Olfr32	T	A	2: 90,138,999	N47Y	possibly damaging	Het
Olfr421-ps1	T	C	1: 174,151,596	Y27H	possibly damaging	Het
Olfr711	T	A	7: 106,971,861	Y161F	probably benign	Het
Olfr773	G	A	10: 129,186,645	P259S	probably damaging	Het
Olfr918	A	G	9: 38,673,363	L27P	probably damaging	Het
Pde2a	A	G	7: 101,502,834	N316S	probably benign	Het
Pde4dip	T	A	3: 97,843,677	R74*	probably null	Het
Pex13	A	T	11: 23,655,472	W253R	possibly damaging	Het
Piezo1	A	T	8: 122,488,539	W1444R	probably damaging	Het
Pla2g4e	T	C	2: 120,167,933	K843R	possibly damaging	Het
Plxna2	C	T	1: 194,644,445	P229L	probably damaging	Het
Prelid3b	G	T	2: 174,466,799	T131K	probably benign	Het
Pros1	T	C	16: 62,889,007		probably null	Het
Prrc2c	G	T	1: 162,697,687	P450Q	unknown	Het
Ptbp1	G	T	10: 79,856,508	V5F	possibly damaging	Het
Ptk2	T	A	15: 73,206,225	L997F	probably damaging	Het
Rims1	G	T	1: 22,479,447	S525*	probably null	Het
Sh2b3	T	A	5: 121,818,634	D318V	probably benign	Het
Slc16a13	A	T	11: 70,220,275	I88N	probably damaging	Het
Slit2	T	A	5: 48,257,003		probably null	Het
Snx10	A	G	6: 51,579,938	N67S	probably damaging	Het
Stil	A	G	4: 115,041,308	Y1045C	probably damaging	Het
Stra6	A	G	9: 58,135,076		probably null	Het
Sympk	A	G	7: 19,054,410	S1254G	probably benign	Het
Syt15	G	T	14: 34,228,054	G377V	probably damaging	Het
Taar4	A	T	10: 23,960,833	I114F	probably damaging	Het
Tcaf3	G	A	6: 42,593,366		probably null	Het
Tgm7	A	T	2: 121,094,021	N558K	probably benign	Het
Tln2	T	G	9: 67,397,653	M1L	probably benign	Het
Trim50	C	T	5: 135,367,140	T314I	probably damaging	Het
Trp53rka	A	T	2: 165,491,392	Y192*	probably null	Het
Ube3b	T	C	5: 114,393,078	V211A	probably benign	Het
Ush2a	A	G	1: 188,399,941	S787G	probably benign	Het
Vmn1r189	T	C	13: 22,102,119	M183V	probably damaging	Het
Vps13d	G	T	4: 145,178,212	Q115K	probably benign	Het
Zfp358	A	G	8: 3,495,493	D25G	probably damaging	Het
Zfp521	T	G	18: 13,844,590	K922T	probably damaging	Het
Zfp521	T	A	18: 13,844,591	K922*	probably null	Het
Zfp68	T	A	5: 138,616,481	K4*	probably null	Het

Other mutations in Nrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrp1	APN	8	128476207	missense	probably benign
IGL01412:Nrp1	APN	8	128418707	splice site	probably benign
IGL01586:Nrp1	APN	8	128432032	missense	possibly damaging	0.86
IGL02307:Nrp1	APN	8	128502720	missense	probably damaging	1.00
IGL02500:Nrp1	APN	8	128425799	missense	possibly damaging	0.94
IGL02547:Nrp1	APN	8	128493031	missense	probably benign
R0046:Nrp1	UTSW	8	128500608	splice site	probably benign
R0281:Nrp1	UTSW	8	128460683	missense	probably damaging	0.96
R0403:Nrp1	UTSW	8	128457969	missense	probably damaging	1.00
R0610:Nrp1	UTSW	8	128502618	missense	probably damaging	1.00
R1055:Nrp1	UTSW	8	128468598	missense	possibly damaging	0.68
R1229:Nrp1	UTSW	8	128418716	nonsense	probably null
R1263:Nrp1	UTSW	8	128468389	missense	probably damaging	1.00
R1340:Nrp1	UTSW	8	128434355	missense	probably damaging	1.00
R1397:Nrp1	UTSW	8	128418716	nonsense	probably null
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1531:Nrp1	UTSW	8	128425969	missense	probably null	0.19
R1587:Nrp1	UTSW	8	128476282	missense	probably damaging	1.00
R1719:Nrp1	UTSW	8	128425885	missense	probably damaging	1.00
R1733:Nrp1	UTSW	8	128468493	missense	probably benign	0.02
R1785:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R1786:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2047:Nrp1	UTSW	8	128498096	splice site	probably benign
R2130:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2132:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2133:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2163:Nrp1	UTSW	8	128497871	missense	probably damaging	1.00
R2338:Nrp1	UTSW	8	128497904	missense	probably benign	0.01
R2407:Nrp1	UTSW	8	128431945	missense	probably damaging	0.99
R3405:Nrp1	UTSW	8	128498088	nonsense	probably null
R3748:Nrp1	UTSW	8	128457980	missense	probably damaging	1.00
R4347:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R4379:Nrp1	UTSW	8	128468467	missense	probably damaging	1.00
R4646:Nrp1	UTSW	8	128457944	missense	probably benign	0.00
R4916:Nrp1	UTSW	8	128502804	nonsense	probably null
R5077:Nrp1	UTSW	8	128500673	critical splice donor site	probably null
R5301:Nrp1	UTSW	8	128434197	splice site	probably null
R5509:Nrp1	UTSW	8	128425915	missense	possibly damaging	0.73
R5745:Nrp1	UTSW	8	128468448	missense	probably benign	0.22
R5873:Nrp1	UTSW	8	128468377	missense	probably damaging	1.00
R5987:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
R6060:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
R6757:Nrp1	UTSW	8	128425868	missense	probably damaging	1.00
R6889:Nrp1	UTSW	8	128493057	missense	probably damaging	1.00
R7025:Nrp1	UTSW	8	128480954	missense	probably damaging	1.00
R7065:Nrp1	UTSW	8	128460712	missense	probably benign
R7290:Nrp1	UTSW	8	128476296	critical splice donor site	probably null
R7369:Nrp1	UTSW	8	128431915	missense	probably damaging	1.00
R7553:Nrp1	UTSW	8	128431987	missense	probably damaging	1.00
R7650:Nrp1	UTSW	8	128498014	missense	possibly damaging	0.87
R8043:Nrp1	UTSW	8	128432023	missense	probably benign	0.00
R8088:Nrp1	UTSW	8	128468516	nonsense	probably null
R8193:Nrp1	UTSW	8	128460706	missense	probably damaging	1.00
R8206:Nrp1	UTSW	8	128457957	missense	probably damaging	0.99
R8245:Nrp1	UTSW	8	128487953	missense	probably benign
R8684:Nrp1	UTSW	8	128359404	start gained	probably benign
R8734:Nrp1	UTSW	8	128480939	missense	probably benign	0.23
R8875:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R9054:Nrp1	UTSW	8	128487908	missense	probably benign
R9253:Nrp1	UTSW	8	128502663	missense	possibly damaging	0.47
R9301:Nrp1	UTSW	8	128363378	missense	probably damaging	1.00
R9437:Nrp1	UTSW	8	128460627	missense	probably benign	0.01
R9606:Nrp1	UTSW	8	128502548	missense	probably benign	0.00
R9607:Nrp1	UTSW	8	128425781	missense	probably benign	0.01
R9691:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
X0066:Nrp1	UTSW	8	128460645	missense	possibly damaging	0.95
Z1186:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1189:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1192:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACACATCTGTCAGCCTAGAGTG -3'
(R):5'- GCCTTCACGCCTCTGAGTAATTAC -3'

Sequencing Primer
(F):5'- CTGTCAGCCTAGAGTGATTTAGAC -3'
(R):5'- TCAAAGTTATAGTTCTCCAGGGCAG -3'

Posted On

2015-10-21