Incidental Mutation 'R4688:Ptbp1'
ID353877
Institutional Source Beutler Lab
Gene Symbol Ptbp1
Ensembl Gene ENSMUSG00000006498
Gene Namepolypyrimidine tract binding protein 1
SynonymsPtb, hnRNP I
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4688 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79854427-79864771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79856508 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 5 (V5F)
Ref Sequence ENSEMBL: ENSMUSP00000127507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000095457] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000167250] [ENSMUST00000168683] [ENSMUST00000169483] [ENSMUST00000171599] [ENSMUST00000172282]
Predicted Effect probably benign
Transcript: ENSMUST00000057343
AA Change: V5F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498
AA Change: V5F

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
AA Change: V5F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498
AA Change: V5F

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165153
Predicted Effect probably benign
Transcript: ENSMUST00000165704
AA Change: V5F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498
AA Change: V5F

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167250
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168521
Predicted Effect probably benign
Transcript: ENSMUST00000168683
SMART Domains Protein: ENSMUSP00000132383
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
SCOP:d2u1a__ 17 55 3e-3 SMART
PDB:2AD9|A 18 55 9e-19 PDB
Blast:RRM 29 55 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168988
Predicted Effect probably benign
Transcript: ENSMUST00000169091
SMART Domains Protein: ENSMUSP00000128449
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 13 19 N/A INTRINSIC
Pfam:RRM_5 29 81 3.5e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169483
AA Change: V5F

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127507
Gene: ENSMUSG00000006498
AA Change: V5F

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171216
Predicted Effect probably benign
Transcript: ENSMUST00000171599
AA Change: V60F

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131296
Gene: ENSMUSG00000006498
AA Change: V60F

DomainStartEndE-ValueType
low complexity region 87 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172282
AA Change: V5F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498
AA Change: V5F

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217802
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA-binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has four repeats of quasi-RNA recognition motif (RRM) domains that bind RNAs. This protein binds to the intronic polypyrimidine tracts that requires pre-mRNA splicing and acts via the protein degradation ubiquitin-proteasome pathway. It may also promote the binding of U2 snRNP to pre-mRNAs. This protein is localized in the nucleoplasm and it is also detected in the perinucleolar structure. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E6.5. Mice homozygous for a conditional allele activated in neuronal stem cells (NSCs) exhibit premature death, and non-obstructive hydrocephaly with loss of ependymal cells due to precocious NSC differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Ptbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Ptbp1 APN 10 79859962 splice site probably benign
IGL01335:Ptbp1 APN 10 79862874 splice site probably null
IGL03119:Ptbp1 APN 10 79859624 missense probably damaging 1.00
R1433:Ptbp1 UTSW 10 79863273 missense probably damaging 1.00
R2418:Ptbp1 UTSW 10 79859677 missense probably damaging 0.98
R4222:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R4223:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R4224:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R5841:Ptbp1 UTSW 10 79859932 missense probably benign 0.31
R6961:Ptbp1 UTSW 10 79859277 splice site probably null
R7242:Ptbp1 UTSW 10 79856388 missense unknown
R7579:Ptbp1 UTSW 10 79859120 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGAGTTGAGTTTTGACCCAGG -3'
(R):5'- TTGGACGGCAGGTCTACATG -3'

Sequencing Primer
(F):5'- CTGGTATGCTTTATAAAAACTGGGC -3'
(R):5'- CTCTGCAATAAGCAAGCC -3'
Posted On2015-10-21