Incidental Mutation 'R4688:Dync1h1'
ID353890
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Namedynein cytoplasmic 1 heavy chain 1
Synonyms9930018I23Rik, Dnchc1, dynein heavy chain, retrograde transport, Swl, MAP1C, Loa, Dnec1
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4688 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location110601452-110666945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110655528 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 3435 (I3435S)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
PDB Structure
Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018851
AA Change: I3435S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: I3435S

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166185
Predicted Effect unknown
Transcript: ENSMUST00000167395
AA Change: I138S
SMART Domains Protein: ENSMUSP00000126117
Gene: ENSMUSG00000018707
AA Change: I138S

DomainStartEndE-ValueType
Pfam:MT 1 178 5.3e-18 PFAM
Pfam:AAA_9 154 252 3.6e-24 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110649104 missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110614107 missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110625607 splice site probably benign
IGL01324:Dync1h1 APN 12 110626865 missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110616692 splice site probably benign
IGL01371:Dync1h1 APN 12 110638851 missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110658128 missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110614940 missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110658930 missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110652196 critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110637124 missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110632820 missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110662559 missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110663002 missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110640888 missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110640210 missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110659232 nonsense probably null
IGL02643:Dync1h1 APN 12 110659272 unclassified probably benign
IGL03076:Dync1h1 APN 12 110657893 missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110666555 unclassified probably null
IGL03293:Dync1h1 APN 12 110628734 missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110619210 missense possibly damaging 0.49
Gesund UTSW 12 110616404 missense probably benign 0.35
gymnast UTSW 12 110618368 missense probably damaging 1.00
Lightfoot UTSW 12 110617920 missense probably damaging 1.00
Lissom UTSW 12 110632820 missense possibly damaging 0.68
Strong UTSW 12 110658126 missense probably damaging 1.00
waters UTSW 12 110629679 missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110649104 missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110616807 missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110636446 missense probably benign
R0110:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110618674 missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110631692 missense probably benign
R0450:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110632788 missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110616496 missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110651747 unclassified probably benign
R0685:Dync1h1 UTSW 12 110657192 missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110612411 missense probably benign
R0747:Dync1h1 UTSW 12 110629284 missense probably damaging 0.99
R0843:Dync1h1 UTSW 12 110665213 missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110665959 missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110649264 missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110656357 missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110665662 critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110626992 missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110632928 splice site probably benign
R1812:Dync1h1 UTSW 12 110662900 missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110662625 missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110624636 missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110646304 missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110662629 missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110625732 missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110666423 critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110614592 missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110649588 missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110629986 missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110640882 missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110656631 missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110641220 missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110643247 missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110616891 missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110641026 critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110640586 missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110643129 missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110631675 missense probably benign
R3736:Dync1h1 UTSW 12 110631675 missense probably benign
R3882:Dync1h1 UTSW 12 110629058 missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110665965 missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110643190 missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110618049 nonsense probably null
R4355:Dync1h1 UTSW 12 110632899 missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110657139 missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110649483 missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110638844 missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110628767 missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110662541 missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110649507 nonsense probably null
R4733:Dync1h1 UTSW 12 110649507 nonsense probably null
R4780:Dync1h1 UTSW 12 110661196 missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110639801 missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110662855 missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110618010 missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110626892 nonsense probably null
R5036:Dync1h1 UTSW 12 110630535 missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110640907 missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110617932 missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110629680 missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110628830 missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110615068 missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110632665 missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110660950 missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110632820 missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110641141 missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110665988 missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110629062 missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110616404 missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110646273 nonsense probably null
R5806:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110614220 critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110618368 missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110632778 missense probably benign
R6113:Dync1h1 UTSW 12 110620414 missense probably benign
R6119:Dync1h1 UTSW 12 110628006 missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110617993 missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110646205 missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110616737 missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110617920 missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110649848 missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110658134 missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110629679 missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110658547 missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110652180 missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110624561 missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110638901 missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110666087 nonsense probably null
R7096:Dync1h1 UTSW 12 110657078 missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110601739 missense probably benign
R7224:Dync1h1 UTSW 12 110617762 missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110664749 critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110665162 missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110635642 missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110624602 missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110634220 missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110636453 missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110636453 missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110665675 missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110651577 missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110614107 missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110630625 missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110660893 missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110618646 missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110665766 missense probably damaging 1.00
Z1088:Dync1h1 UTSW 12 110629917 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTATAACCCAGGCTGCTTCAG -3'
(R):5'- GCACTGTTGACCTTGGCTTC -3'

Sequencing Primer
(F):5'- ACGCCAGGGTCACAAGC -3'
(R):5'- TGACCTTGGCTTCCCGCAG -3'
Posted On2015-10-21