Mutagenetix > Incidental Mutation

Incidental Mutation 'R0276:Psme4'

35390

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

038498-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0276 (G1)

Quality Score

187

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30811980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 440 (T440K)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: T440K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: T440K

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133430

Meta Mutation Damage Score

0.6430

Coding Region Coverage

1x: 98.7%
3x: 97.8%
10x: 96.2%
20x: 93.8%

Validation Efficiency

98% (101/103)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts13	A	G	2: 26,975,760	N109S	possibly damaging	Het
Adcy10	T	A	1: 165,572,591	M1523K	possibly damaging	Het
Agtpbp1	C	T	13: 59,462,031	S1095N	possibly damaging	Het
Ang2	C	T	14: 51,195,518	V136I	probably damaging	Het
Arhgap10	A	T	8: 77,413,581	M250K	probably benign	Het
Arhgap33	A	T	7: 30,523,244	W1088R	probably benign	Het
Arhgef15	T	C	11: 68,953,472		probably benign	Het
Aspm	T	C	1: 139,478,471	S1699P	possibly damaging	Het
Atp12a	C	A	14: 56,387,694	D1014E	probably damaging	Het
Atp1a4	T	A	1: 172,257,901	K45M	probably damaging	Het
Atp8a1	A	T	5: 67,786,673		probably benign	Het
Baiap3	A	C	17: 25,243,687	F1099C	probably damaging	Het
Bcas3	T	A	11: 85,470,837		probably null	Het
Bms1	G	A	6: 118,408,134	T371M	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Capn3	T	C	2: 120,488,065		probably benign	Het
Ccdc180	A	G	4: 45,923,534	D1105G	probably damaging	Het
Ccdc33	G	T	9: 58,058,392	P364Q	probably damaging	Het
Ccdc36	A	T	9: 108,428,440	M11K	possibly damaging	Het
Clstn3	A	G	6: 124,431,740		probably benign	Het
Cntrl	A	T	2: 35,151,732	Y619F	possibly damaging	Het
Col12a1	A	T	9: 79,630,741	Y2514*	probably null	Het
Cpt1b	T	C	15: 89,419,959	H503R	probably benign	Het
Crb1	T	A	1: 139,323,335	T293S	possibly damaging	Het
D130043K22Rik	C	T	13: 24,858,045	T319I	possibly damaging	Het
Dzip1l	G	A	9: 99,660,998	R502Q	probably benign	Het
Efcab5	A	G	11: 77,129,876	M673T	probably damaging	Het
Efcab5	G	A	11: 77,140,923	R42W	probably damaging	Het
F2rl3	A	G	8: 72,762,798	T218A	probably benign	Het
Fam135a	C	T	1: 24,067,964	R31H	probably damaging	Het
Fam84b	G	T	15: 60,823,674	Y74*	probably null	Het
Fcer2a	A	T	8: 3,689,811	N53K	possibly damaging	Het
Gm14085	T	A	2: 122,521,928	S389T	probably damaging	Het
Golgb1	A	C	16: 36,913,876	K1162Q	probably damaging	Het
Gpr137b	A	T	13: 13,367,575		probably benign	Het
Haspin	A	T	11: 73,136,487	L592Q	probably damaging	Het
Helq	A	G	5: 100,790,147	F478L	probably damaging	Het
Il17rb	T	A	14: 30,004,380	T84S	probably damaging	Het
Itga4	T	C	2: 79,321,493	L880P	probably damaging	Het
Itih5	A	G	2: 10,185,564	I61V	possibly damaging	Het
Ivl	G	A	3: 92,571,514	L415F	unknown	Het
Kif2a	A	G	13: 106,976,650		probably benign	Het
Kmt2d	T	C	15: 98,850,311		probably benign	Het
Lars2	A	G	9: 123,438,121		probably benign	Het
Lilrb4a	T	C	10: 51,491,581	V73A	probably benign	Het
Lrrc8a	A	G	2: 30,256,788	D538G	possibly damaging	Het
Lrrk1	G	A	7: 66,296,263		probably benign	Het
Mc2r	A	T	18: 68,408,132	I30K	possibly damaging	Het
Mybbp1a	C	A	11: 72,450,107		probably null	Het
Napg	C	T	18: 62,986,963	R149C	probably damaging	Het
Ncam2	A	G	16: 81,517,629		probably benign	Het
Nlk	T	C	11: 78,571,475	I509V	probably benign	Het
Nlrp2	A	T	7: 5,328,109	N429K	probably benign	Het
Nlrp9b	A	G	7: 20,028,498	T247A	probably benign	Het
Noxo1	A	T	17: 24,700,162		probably null	Het
Olfr1212	T	A	2: 88,958,755	C96*	probably null	Het
Olfr139	A	G	11: 74,045,118	I52T	probably damaging	Het
Olfr353	A	T	2: 36,890,023	M275K	probably benign	Het
Olfr701	A	T	7: 106,818,697	I205L	probably benign	Het
Olfr734	C	A	14: 50,320,179	A219S	probably benign	Het
Oxr1	T	C	15: 41,820,062	S294P	probably damaging	Het
Pfpl	A	G	19: 12,429,237	Y284C	probably damaging	Het
Pi16	A	T	17: 29,326,943	T232S	probably benign	Het
Plcxd2	A	T	16: 46,009,707	N50K	probably benign	Het
Plekhn1	T	A	4: 156,228,246	N52Y	probably damaging	Het
Prl2c5	T	C	13: 13,183,049		probably benign	Het
Prrc2b	G	A	2: 32,219,654	V1080I	probably damaging	Het
Psg28	A	T	7: 18,430,396	N130K	probably benign	Het
Ptcd2	T	C	13: 99,321,596	K296E	probably benign	Het
Ptprq	T	C	10: 107,542,735		probably null	Het
Rab5b	A	C	10: 128,686,746		probably null	Het
Rft1	T	A	14: 30,690,583	S534T	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rsu1	A	T	2: 13,170,135		probably benign	Het
Senp6	A	G	9: 80,136,747	M887V	probably benign	Het
Sgcz	T	A	8: 37,952,919	M60L	probably benign	Het
Siglec1	G	A	2: 131,083,941	Q282*	probably null	Het
Sipa1l2	T	C	8: 125,421,940	T1655A	probably damaging	Het
Slc43a3	G	A	2: 84,937,663		probably benign	Het
Snx29	T	C	16: 11,738,373	V756A	probably benign	Het
Spta1	T	A	1: 174,217,894	H1539Q	probably damaging	Het
Stk3	A	C	15: 35,099,469	S104A	probably damaging	Het
Stk38	C	A	17: 28,992,416		probably null	Het
Stx6	T	C	1: 155,174,163		probably benign	Het
Thbs4	G	A	13: 92,775,532	T230I	probably benign	Het
Thrsp	A	G	7: 97,417,502	M1T	probably null	Het
Tmem63b	A	T	17: 45,675,373		probably benign	Het
Top2a	A	G	11: 99,009,907		probably benign	Het
Tpd52l2	T	C	2: 181,502,059		probably null	Het
Trak1	A	G	9: 121,454,338	E390G	probably damaging	Het
Trappc3	T	A	4: 126,273,952	D101E	possibly damaging	Het
Trhr	A	G	15: 44,197,086	M1V	probably null	Het
Triobp	T	A	15: 78,973,676	I1159K	probably benign	Het
Unc45a	A	G	7: 80,326,297		probably benign	Het
Usb1	A	G	8: 95,333,457	D12G	probably damaging	Het
Ushbp1	C	T	8: 71,394,649	C113Y	possibly damaging	Het
Vim	A	G	2: 13,574,859	K143R	probably benign	Het
Vmn2r75	T	C	7: 86,148,307	K766R	probably benign	Het
Wdr92	T	C	11: 17,229,821	I274T	probably benign	Het
Xpo5	T	G	17: 46,241,507	C1089G	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGCTACAGGAGACCTTATCTCCA -3'
(R):5'- TCTACCCCAGGCAATGCTCTCA -3'

Sequencing Primer
(F):5'- acaggagaccttatctccaaaaag -3'
(R):5'- TGCTCTCATCAACAGAGGTAG -3'

Posted On

2013-05-09