Incidental Mutation 'R0276:Arhgef15'
Institutional Source Beutler Lab
Gene Symbol Arhgef15
Ensembl Gene ENSMUSG00000052921
Gene NameRho guanine nucleotide exchange factor (GEF) 15
MMRRC Submission 038498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0276 (G1)
Quality Score225
Status Validated
Chromosomal Location68943155-68957480 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 68953472 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065040] [ENSMUST00000108671]
Predicted Effect probably benign
Transcript: ENSMUST00000065040
SMART Domains Protein: ENSMUSP00000067684
Gene: ENSMUSG00000052921

low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108670
Predicted Effect probably benign
Transcript: ENSMUST00000108671
SMART Domains Protein: ENSMUSP00000104311
Gene: ENSMUSG00000052921

low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock out allele exhibit increased excitatory synapse formation. Mice homozygous for a knock-out allele exhibit delayed radial growth, sparse vasculature and empty baselment membrane sleeves in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,975,760 N109S possibly damaging Het
Adcy10 T A 1: 165,572,591 M1523K possibly damaging Het
Agtpbp1 C T 13: 59,462,031 S1095N possibly damaging Het
Ang2 C T 14: 51,195,518 V136I probably damaging Het
Arhgap10 A T 8: 77,413,581 M250K probably benign Het
Arhgap33 A T 7: 30,523,244 W1088R probably benign Het
Aspm T C 1: 139,478,471 S1699P possibly damaging Het
Atp12a C A 14: 56,387,694 D1014E probably damaging Het
Atp1a4 T A 1: 172,257,901 K45M probably damaging Het
Atp8a1 A T 5: 67,786,673 probably benign Het
Baiap3 A C 17: 25,243,687 F1099C probably damaging Het
Bcas3 T A 11: 85,470,837 probably null Het
Bms1 G A 6: 118,408,134 T371M possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Capn3 T C 2: 120,488,065 probably benign Het
Ccdc180 A G 4: 45,923,534 D1105G probably damaging Het
Ccdc33 G T 9: 58,058,392 P364Q probably damaging Het
Ccdc36 A T 9: 108,428,440 M11K possibly damaging Het
Clstn3 A G 6: 124,431,740 probably benign Het
Cntrl A T 2: 35,151,732 Y619F possibly damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Cpt1b T C 15: 89,419,959 H503R probably benign Het
Crb1 T A 1: 139,323,335 T293S possibly damaging Het
D130043K22Rik C T 13: 24,858,045 T319I possibly damaging Het
Dzip1l G A 9: 99,660,998 R502Q probably benign Het
Efcab5 A G 11: 77,129,876 M673T probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
F2rl3 A G 8: 72,762,798 T218A probably benign Het
Fam135a C T 1: 24,067,964 R31H probably damaging Het
Fam84b G T 15: 60,823,674 Y74* probably null Het
Fcer2a A T 8: 3,689,811 N53K possibly damaging Het
Gm14085 T A 2: 122,521,928 S389T probably damaging Het
Golgb1 A C 16: 36,913,876 K1162Q probably damaging Het
Gpr137b A T 13: 13,367,575 probably benign Het
Haspin A T 11: 73,136,487 L592Q probably damaging Het
Helq A G 5: 100,790,147 F478L probably damaging Het
Il17rb T A 14: 30,004,380 T84S probably damaging Het
Itga4 T C 2: 79,321,493 L880P probably damaging Het
Itih5 A G 2: 10,185,564 I61V possibly damaging Het
Ivl G A 3: 92,571,514 L415F unknown Het
Kif2a A G 13: 106,976,650 probably benign Het
Kmt2d T C 15: 98,850,311 probably benign Het
Lars2 A G 9: 123,438,121 probably benign Het
Lilrb4a T C 10: 51,491,581 V73A probably benign Het
Lrrc8a A G 2: 30,256,788 D538G possibly damaging Het
Lrrk1 G A 7: 66,296,263 probably benign Het
Mc2r A T 18: 68,408,132 I30K possibly damaging Het
Mybbp1a C A 11: 72,450,107 probably null Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ncam2 A G 16: 81,517,629 probably benign Het
Nlk T C 11: 78,571,475 I509V probably benign Het
Nlrp2 A T 7: 5,328,109 N429K probably benign Het
Nlrp9b A G 7: 20,028,498 T247A probably benign Het
Noxo1 A T 17: 24,700,162 probably null Het
Olfr1212 T A 2: 88,958,755 C96* probably null Het
Olfr139 A G 11: 74,045,118 I52T probably damaging Het
Olfr353 A T 2: 36,890,023 M275K probably benign Het
Olfr701 A T 7: 106,818,697 I205L probably benign Het
Olfr734 C A 14: 50,320,179 A219S probably benign Het
Oxr1 T C 15: 41,820,062 S294P probably damaging Het
Pfpl A G 19: 12,429,237 Y284C probably damaging Het
Pi16 A T 17: 29,326,943 T232S probably benign Het
Plcxd2 A T 16: 46,009,707 N50K probably benign Het
Plekhn1 T A 4: 156,228,246 N52Y probably damaging Het
Prl2c5 T C 13: 13,183,049 probably benign Het
Prrc2b G A 2: 32,219,654 V1080I probably damaging Het
Psg28 A T 7: 18,430,396 N130K probably benign Het
Psme4 C A 11: 30,811,980 T440K probably damaging Het
Ptcd2 T C 13: 99,321,596 K296E probably benign Het
Ptprq T C 10: 107,542,735 probably null Het
Rab5b A C 10: 128,686,746 probably null Het
Rft1 T A 14: 30,690,583 S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rsu1 A T 2: 13,170,135 probably benign Het
Senp6 A G 9: 80,136,747 M887V probably benign Het
Sgcz T A 8: 37,952,919 M60L probably benign Het
Siglec1 G A 2: 131,083,941 Q282* probably null Het
Sipa1l2 T C 8: 125,421,940 T1655A probably damaging Het
Slc43a3 G A 2: 84,937,663 probably benign Het
Snx29 T C 16: 11,738,373 V756A probably benign Het
Spta1 T A 1: 174,217,894 H1539Q probably damaging Het
Stk3 A C 15: 35,099,469 S104A probably damaging Het
Stk38 C A 17: 28,992,416 probably null Het
Stx6 T C 1: 155,174,163 probably benign Het
Thbs4 G A 13: 92,775,532 T230I probably benign Het
Thrsp A G 7: 97,417,502 M1T probably null Het
Tmem63b A T 17: 45,675,373 probably benign Het
Top2a A G 11: 99,009,907 probably benign Het
Tpd52l2 T C 2: 181,502,059 probably null Het
Trak1 A G 9: 121,454,338 E390G probably damaging Het
Trappc3 T A 4: 126,273,952 D101E possibly damaging Het
Trhr A G 15: 44,197,086 M1V probably null Het
Triobp T A 15: 78,973,676 I1159K probably benign Het
Unc45a A G 7: 80,326,297 probably benign Het
Usb1 A G 8: 95,333,457 D12G probably damaging Het
Ushbp1 C T 8: 71,394,649 C113Y possibly damaging Het
Vim A G 2: 13,574,859 K143R probably benign Het
Vmn2r75 T C 7: 86,148,307 K766R probably benign Het
Wdr92 T C 11: 17,229,821 I274T probably benign Het
Xpo5 T G 17: 46,241,507 C1089G probably damaging Het
Other mutations in Arhgef15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Arhgef15 APN 11 68954102 missense probably damaging 1.00
IGL02382:Arhgef15 APN 11 68954030 missense probably damaging 0.98
R0041:Arhgef15 UTSW 11 68954516 missense possibly damaging 0.92
R0208:Arhgef15 UTSW 11 68946373 missense probably benign 0.09
R0368:Arhgef15 UTSW 11 68954693 missense probably damaging 0.99
R0706:Arhgef15 UTSW 11 68954576 missense probably damaging 1.00
R1628:Arhgef15 UTSW 11 68944814 missense possibly damaging 0.86
R1966:Arhgef15 UTSW 11 68954675 missense probably damaging 1.00
R2105:Arhgef15 UTSW 11 68947681 splice site probably null
R2278:Arhgef15 UTSW 11 68951691 missense probably damaging 1.00
R4667:Arhgef15 UTSW 11 68954561 missense probably benign 0.00
R4836:Arhgef15 UTSW 11 68949925 intron probably benign
R4898:Arhgef15 UTSW 11 68951345 missense probably benign 0.00
R4966:Arhgef15 UTSW 11 68947317 missense probably benign 0.08
R5304:Arhgef15 UTSW 11 68947237 missense probably null 0.32
R5333:Arhgef15 UTSW 11 68947196 intron probably benign
R5546:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5632:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5707:Arhgef15 UTSW 11 68954715 missense probably damaging 0.98
R5839:Arhgef15 UTSW 11 68954156 missense probably benign 0.00
R5926:Arhgef15 UTSW 11 68951955 missense possibly damaging 0.76
R6376:Arhgef15 UTSW 11 68954970 missense unknown
R6429:Arhgef15 UTSW 11 68947796 missense probably damaging 1.00
R6526:Arhgef15 UTSW 11 68949994 missense probably damaging 1.00
R6749:Arhgef15 UTSW 11 68954557 missense probably damaging 0.99
R7460:Arhgef15 UTSW 11 68947035 missense probably damaging 1.00
R7529:Arhgef15 UTSW 11 68954022 missense probably damaging 1.00
R7598:Arhgef15 UTSW 11 68946410 missense probably damaging 1.00
R7767:Arhgef15 UTSW 11 68953847 missense probably damaging 0.99
R7919:Arhgef15 UTSW 11 68947605 missense probably benign 0.00
R8488:Arhgef15 UTSW 11 68947670 critical splice acceptor site probably null
R8818:Arhgef15 UTSW 11 68951112 missense probably damaging 0.99
X0067:Arhgef15 UTSW 11 68944830 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttgtttgtttgtttgttgcttttg -3'
(R):5'- gtgaggggtggggatgg -3'
Posted On2013-05-09