Incidental Mutation 'R0276:Mybbp1a'
ID35392
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene NameMYB binding protein (P160) 1a
Synonymsp160MBP, p67MBP
MMRRC Submission 038498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0276 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72441355-72451768 bp(+) (GRCm38)
Type of Mutationsplice site (2625 bp from exon)
DNA Base Change (assembly) C to A at 72450107 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303] [ENSMUST00000045633]
Predicted Effect probably null
Transcript: ENSMUST00000045303
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect probably null
Transcript: ENSMUST00000144940
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,975,760 N109S possibly damaging Het
Adcy10 T A 1: 165,572,591 M1523K possibly damaging Het
Agtpbp1 C T 13: 59,462,031 S1095N possibly damaging Het
Ang2 C T 14: 51,195,518 V136I probably damaging Het
Arhgap10 A T 8: 77,413,581 M250K probably benign Het
Arhgap33 A T 7: 30,523,244 W1088R probably benign Het
Arhgef15 T C 11: 68,953,472 probably benign Het
Aspm T C 1: 139,478,471 S1699P possibly damaging Het
Atp12a C A 14: 56,387,694 D1014E probably damaging Het
Atp1a4 T A 1: 172,257,901 K45M probably damaging Het
Atp8a1 A T 5: 67,786,673 probably benign Het
Baiap3 A C 17: 25,243,687 F1099C probably damaging Het
Bcas3 T A 11: 85,470,837 probably null Het
Bms1 G A 6: 118,408,134 T371M possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Capn3 T C 2: 120,488,065 probably benign Het
Ccdc180 A G 4: 45,923,534 D1105G probably damaging Het
Ccdc33 G T 9: 58,058,392 P364Q probably damaging Het
Ccdc36 A T 9: 108,428,440 M11K possibly damaging Het
Clstn3 A G 6: 124,431,740 probably benign Het
Cntrl A T 2: 35,151,732 Y619F possibly damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Cpt1b T C 15: 89,419,959 H503R probably benign Het
Crb1 T A 1: 139,323,335 T293S possibly damaging Het
D130043K22Rik C T 13: 24,858,045 T319I possibly damaging Het
Dzip1l G A 9: 99,660,998 R502Q probably benign Het
Efcab5 A G 11: 77,129,876 M673T probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
F2rl3 A G 8: 72,762,798 T218A probably benign Het
Fam135a C T 1: 24,067,964 R31H probably damaging Het
Fam84b G T 15: 60,823,674 Y74* probably null Het
Fcer2a A T 8: 3,689,811 N53K possibly damaging Het
Gm14085 T A 2: 122,521,928 S389T probably damaging Het
Golgb1 A C 16: 36,913,876 K1162Q probably damaging Het
Gpr137b A T 13: 13,367,575 probably benign Het
Haspin A T 11: 73,136,487 L592Q probably damaging Het
Helq A G 5: 100,790,147 F478L probably damaging Het
Il17rb T A 14: 30,004,380 T84S probably damaging Het
Itga4 T C 2: 79,321,493 L880P probably damaging Het
Itih5 A G 2: 10,185,564 I61V possibly damaging Het
Ivl G A 3: 92,571,514 L415F unknown Het
Kif2a A G 13: 106,976,650 probably benign Het
Kmt2d T C 15: 98,850,311 probably benign Het
Lars2 A G 9: 123,438,121 probably benign Het
Lilrb4a T C 10: 51,491,581 V73A probably benign Het
Lrrc8a A G 2: 30,256,788 D538G possibly damaging Het
Lrrk1 G A 7: 66,296,263 probably benign Het
Mc2r A T 18: 68,408,132 I30K possibly damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ncam2 A G 16: 81,517,629 probably benign Het
Nlk T C 11: 78,571,475 I509V probably benign Het
Nlrp2 A T 7: 5,328,109 N429K probably benign Het
Nlrp9b A G 7: 20,028,498 T247A probably benign Het
Noxo1 A T 17: 24,700,162 probably null Het
Olfr1212 T A 2: 88,958,755 C96* probably null Het
Olfr139 A G 11: 74,045,118 I52T probably damaging Het
Olfr353 A T 2: 36,890,023 M275K probably benign Het
Olfr701 A T 7: 106,818,697 I205L probably benign Het
Olfr734 C A 14: 50,320,179 A219S probably benign Het
Oxr1 T C 15: 41,820,062 S294P probably damaging Het
Pfpl A G 19: 12,429,237 Y284C probably damaging Het
Pi16 A T 17: 29,326,943 T232S probably benign Het
Plcxd2 A T 16: 46,009,707 N50K probably benign Het
Plekhn1 T A 4: 156,228,246 N52Y probably damaging Het
Prl2c5 T C 13: 13,183,049 probably benign Het
Prrc2b G A 2: 32,219,654 V1080I probably damaging Het
Psg28 A T 7: 18,430,396 N130K probably benign Het
Psme4 C A 11: 30,811,980 T440K probably damaging Het
Ptcd2 T C 13: 99,321,596 K296E probably benign Het
Ptprq T C 10: 107,542,735 probably null Het
Rab5b A C 10: 128,686,746 probably null Het
Rft1 T A 14: 30,690,583 S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rsu1 A T 2: 13,170,135 probably benign Het
Senp6 A G 9: 80,136,747 M887V probably benign Het
Sgcz T A 8: 37,952,919 M60L probably benign Het
Siglec1 G A 2: 131,083,941 Q282* probably null Het
Sipa1l2 T C 8: 125,421,940 T1655A probably damaging Het
Slc43a3 G A 2: 84,937,663 probably benign Het
Snx29 T C 16: 11,738,373 V756A probably benign Het
Spta1 T A 1: 174,217,894 H1539Q probably damaging Het
Stk3 A C 15: 35,099,469 S104A probably damaging Het
Stk38 C A 17: 28,992,416 probably null Het
Stx6 T C 1: 155,174,163 probably benign Het
Thbs4 G A 13: 92,775,532 T230I probably benign Het
Thrsp A G 7: 97,417,502 M1T probably null Het
Tmem63b A T 17: 45,675,373 probably benign Het
Top2a A G 11: 99,009,907 probably benign Het
Tpd52l2 T C 2: 181,502,059 probably null Het
Trak1 A G 9: 121,454,338 E390G probably damaging Het
Trappc3 T A 4: 126,273,952 D101E possibly damaging Het
Trhr A G 15: 44,197,086 M1V probably null Het
Triobp T A 15: 78,973,676 I1159K probably benign Het
Unc45a A G 7: 80,326,297 probably benign Het
Usb1 A G 8: 95,333,457 D12G probably damaging Het
Ushbp1 C T 8: 71,394,649 C113Y possibly damaging Het
Vim A G 2: 13,574,859 K143R probably benign Het
Vmn2r75 T C 7: 86,148,307 K766R probably benign Het
Wdr92 T C 11: 17,229,821 I274T probably benign Het
Xpo5 T G 17: 46,241,507 C1089G probably damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72443567 missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72445666 missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72443918 splice site probably benign
IGL03344:Mybbp1a APN 11 72445202 missense probably damaging 1.00
fratelli UTSW 11 72445712 missense probably benign 0.02
nonnae UTSW 11 72446012 missense probably damaging 1.00
sorelli UTSW 11 72447759 missense possibly damaging 0.94
R0437:Mybbp1a UTSW 11 72448848 missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72448376 missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72443648 missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72445217 missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72441445 missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72446195 missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72448737 missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72447170 missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72451287 missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72445712 missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72447971 missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72445640 missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72445214 missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72448113 missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72450636 missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72446172 missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72444925 missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72442431 missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72446012 missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72447566 missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72447642 splice site probably null
R7227:Mybbp1a UTSW 11 72447759 missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72443512 missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72451275 missense probably benign 0.01
R7833:Mybbp1a UTSW 11 72442901 splice site probably null
R8213:Mybbp1a UTSW 11 72444721 missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72445288 critical splice donor site probably null
X0050:Mybbp1a UTSW 11 72441677 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TACCCAACTCTTGGGAAAGGCCAC -3'
(R):5'- TCTTTCTGGCACACAGTAACACAGC -3'

Sequencing Primer
(F):5'- CTGGTAACCAGATTGCTTGGAAC -3'
(R):5'- CAGTAACACAGCCTCCCTC -3'
Posted On2013-05-09