Incidental Mutation 'R0276:Mybbp1a'
ID 35392
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene Name MYB binding protein (P160) 1a
Synonyms p67MBP, p160MBP
MMRRC Submission 038498-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0276 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 72332181-72342594 bp(+) (GRCm39)
Type of Mutation splice site (2625 bp from exon)
DNA Base Change (assembly) C to A at 72340933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303] [ENSMUST00000045633]
AlphaFold Q7TPV4
Predicted Effect probably null
Transcript: ENSMUST00000045303
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect probably null
Transcript: ENSMUST00000144940
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,865,772 (GRCm39) N109S possibly damaging Het
Adcy10 T A 1: 165,400,160 (GRCm39) M1523K possibly damaging Het
Agtpbp1 C T 13: 59,609,845 (GRCm39) S1095N possibly damaging Het
Ang2 C T 14: 51,432,975 (GRCm39) V136I probably damaging Het
Arhgap10 A T 8: 78,140,210 (GRCm39) M250K probably benign Het
Arhgap33 A T 7: 30,222,669 (GRCm39) W1088R probably benign Het
Arhgef15 T C 11: 68,844,298 (GRCm39) probably benign Het
Aspm T C 1: 139,406,209 (GRCm39) S1699P possibly damaging Het
Atp12a C A 14: 56,625,151 (GRCm39) D1014E probably damaging Het
Atp1a4 T A 1: 172,085,468 (GRCm39) K45M probably damaging Het
Atp8a1 A T 5: 67,944,016 (GRCm39) probably benign Het
Baiap3 A C 17: 25,462,661 (GRCm39) F1099C probably damaging Het
Bcas3 T A 11: 85,361,663 (GRCm39) probably null Het
Bms1 G A 6: 118,385,095 (GRCm39) T371M possibly damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Capn3 T C 2: 120,318,546 (GRCm39) probably benign Het
Ccdc180 A G 4: 45,923,534 (GRCm39) D1105G probably damaging Het
Ccdc33 G T 9: 57,965,675 (GRCm39) P364Q probably damaging Het
Clstn3 A G 6: 124,408,699 (GRCm39) probably benign Het
Cntrl A T 2: 35,041,744 (GRCm39) Y619F possibly damaging Het
Col12a1 A T 9: 79,538,023 (GRCm39) Y2514* probably null Het
Cpt1b T C 15: 89,304,162 (GRCm39) H503R probably benign Het
Crb1 T A 1: 139,251,073 (GRCm39) T293S possibly damaging Het
D130043K22Rik C T 13: 25,042,028 (GRCm39) T319I possibly damaging Het
Dnaaf10 T C 11: 17,179,821 (GRCm39) I274T probably benign Het
Dzip1l G A 9: 99,543,051 (GRCm39) R502Q probably benign Het
Efcab5 A G 11: 77,020,702 (GRCm39) M673T probably damaging Het
Efcab5 G A 11: 77,031,749 (GRCm39) R42W probably damaging Het
F2rl3 A G 8: 73,489,426 (GRCm39) T218A probably benign Het
Fam135a C T 1: 24,107,045 (GRCm39) R31H probably damaging Het
Fcer2a A T 8: 3,739,811 (GRCm39) N53K possibly damaging Het
Golgb1 A C 16: 36,734,238 (GRCm39) K1162Q probably damaging Het
Gpr137b A T 13: 13,542,160 (GRCm39) probably benign Het
Haspin A T 11: 73,027,313 (GRCm39) L592Q probably damaging Het
Helq A G 5: 100,938,013 (GRCm39) F478L probably damaging Het
Iho1 A T 9: 108,305,639 (GRCm39) M11K possibly damaging Het
Il17rb T A 14: 29,726,337 (GRCm39) T84S probably damaging Het
Itga4 T C 2: 79,151,837 (GRCm39) L880P probably damaging Het
Itih5 A G 2: 10,190,375 (GRCm39) I61V possibly damaging Het
Ivl G A 3: 92,478,821 (GRCm39) L415F unknown Het
Kif2a A G 13: 107,113,158 (GRCm39) probably benign Het
Kmt2d T C 15: 98,748,192 (GRCm39) probably benign Het
Lars2 A G 9: 123,267,186 (GRCm39) probably benign Het
Lilrb4a T C 10: 51,367,677 (GRCm39) V73A probably benign Het
Lratd2 G T 15: 60,695,523 (GRCm39) Y74* probably null Het
Lrrc8a A G 2: 30,146,800 (GRCm39) D538G possibly damaging Het
Lrrk1 G A 7: 65,946,011 (GRCm39) probably benign Het
Mc2r A T 18: 68,541,203 (GRCm39) I30K possibly damaging Het
Napg C T 18: 63,120,034 (GRCm39) R149C probably damaging Het
Ncam2 A G 16: 81,314,517 (GRCm39) probably benign Het
Nlk T C 11: 78,462,301 (GRCm39) I509V probably benign Het
Nlrp2 A T 7: 5,331,108 (GRCm39) N429K probably benign Het
Nlrp9b A G 7: 19,762,423 (GRCm39) T247A probably benign Het
Noxo1 A T 17: 24,919,136 (GRCm39) probably null Het
Or1n1b A T 2: 36,780,035 (GRCm39) M275K probably benign Het
Or2ag2b A T 7: 106,417,904 (GRCm39) I205L probably benign Het
Or3a10 A G 11: 73,935,944 (GRCm39) I52T probably damaging Het
Or4c107 T A 2: 88,789,099 (GRCm39) C96* probably null Het
Or4m1 C A 14: 50,557,636 (GRCm39) A219S probably benign Het
Oxr1 T C 15: 41,683,458 (GRCm39) S294P probably damaging Het
Pfpl A G 19: 12,406,601 (GRCm39) Y284C probably damaging Het
Pi16 A T 17: 29,545,917 (GRCm39) T232S probably benign Het
Plcxd2 A T 16: 45,830,070 (GRCm39) N50K probably benign Het
Plekhn1 T A 4: 156,312,703 (GRCm39) N52Y probably damaging Het
Prl2c5 T C 13: 13,357,634 (GRCm39) probably benign Het
Prrc2b G A 2: 32,109,666 (GRCm39) V1080I probably damaging Het
Psg28 A T 7: 18,164,321 (GRCm39) N130K probably benign Het
Psme4 C A 11: 30,761,980 (GRCm39) T440K probably damaging Het
Ptcd2 T C 13: 99,458,104 (GRCm39) K296E probably benign Het
Ptprq T C 10: 107,378,596 (GRCm39) probably null Het
Rab5b A C 10: 128,522,615 (GRCm39) probably null Het
Rft1 T A 14: 30,412,540 (GRCm39) S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rsu1 A T 2: 13,174,946 (GRCm39) probably benign Het
Senp6 A G 9: 80,044,029 (GRCm39) M887V probably benign Het
Sgcz T A 8: 38,420,073 (GRCm39) M60L probably benign Het
Siglec1 G A 2: 130,925,861 (GRCm39) Q282* probably null Het
Sipa1l2 T C 8: 126,148,679 (GRCm39) T1655A probably damaging Het
Slc28a2b T A 2: 122,352,409 (GRCm39) S389T probably damaging Het
Slc43a3 G A 2: 84,768,007 (GRCm39) probably benign Het
Snx29 T C 16: 11,556,237 (GRCm39) V756A probably benign Het
Spta1 T A 1: 174,045,460 (GRCm39) H1539Q probably damaging Het
Stk3 A C 15: 35,099,615 (GRCm39) S104A probably damaging Het
Stk38 C A 17: 29,211,390 (GRCm39) probably null Het
Stx6 T C 1: 155,049,909 (GRCm39) probably benign Het
Thbs4 G A 13: 92,912,040 (GRCm39) T230I probably benign Het
Thrsp A G 7: 97,066,709 (GRCm39) M1T probably null Het
Tmem63b A T 17: 45,986,299 (GRCm39) probably benign Het
Top2a A G 11: 98,900,733 (GRCm39) probably benign Het
Tpd52l2 T C 2: 181,143,852 (GRCm39) probably null Het
Trak1 A G 9: 121,283,404 (GRCm39) E390G probably damaging Het
Trappc3 T A 4: 126,167,745 (GRCm39) D101E possibly damaging Het
Trhr A G 15: 44,060,482 (GRCm39) M1V probably null Het
Triobp T A 15: 78,857,876 (GRCm39) I1159K probably benign Het
Unc45a A G 7: 79,976,045 (GRCm39) probably benign Het
Usb1 A G 8: 96,060,085 (GRCm39) D12G probably damaging Het
Ushbp1 C T 8: 71,847,293 (GRCm39) C113Y possibly damaging Het
Vim A G 2: 13,579,670 (GRCm39) K143R probably benign Het
Vmn2r75 T C 7: 85,797,515 (GRCm39) K766R probably benign Het
Xpo5 T G 17: 46,552,433 (GRCm39) C1089G probably damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72,334,393 (GRCm39) missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72,336,492 (GRCm39) missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72,334,744 (GRCm39) splice site probably benign
IGL03344:Mybbp1a APN 11 72,336,028 (GRCm39) missense probably damaging 1.00
fratelli UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
primi UTSW 11 72,333,727 (GRCm39) splice site probably null
sorelli UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R0437:Mybbp1a UTSW 11 72,339,674 (GRCm39) missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72,339,202 (GRCm39) missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72,334,474 (GRCm39) missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72,336,043 (GRCm39) missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72,332,271 (GRCm39) missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72,337,021 (GRCm39) missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72,339,563 (GRCm39) missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72,337,996 (GRCm39) missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72,342,113 (GRCm39) missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72,338,797 (GRCm39) missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72,336,466 (GRCm39) missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72,336,040 (GRCm39) missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72,338,939 (GRCm39) missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72,341,462 (GRCm39) missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72,336,998 (GRCm39) missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72,335,751 (GRCm39) missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72,333,257 (GRCm39) missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72,336,838 (GRCm39) missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72,338,392 (GRCm39) missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72,338,468 (GRCm39) splice site probably null
R7227:Mybbp1a UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72,334,338 (GRCm39) missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72,342,101 (GRCm39) missense probably benign 0.01
R7833:Mybbp1a UTSW 11 72,333,727 (GRCm39) splice site probably null
R8213:Mybbp1a UTSW 11 72,335,547 (GRCm39) missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72,336,114 (GRCm39) critical splice donor site probably null
R8474:Mybbp1a UTSW 11 72,338,563 (GRCm39) missense probably benign 0.01
R8972:Mybbp1a UTSW 11 72,337,076 (GRCm39) missense probably benign 0.35
R9018:Mybbp1a UTSW 11 72,334,420 (GRCm39) missense probably benign 0.09
R9380:Mybbp1a UTSW 11 72,333,668 (GRCm39) missense probably benign 0.24
R9505:Mybbp1a UTSW 11 72,339,897 (GRCm39) missense probably benign 0.26
X0050:Mybbp1a UTSW 11 72,332,503 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TACCCAACTCTTGGGAAAGGCCAC -3'
(R):5'- TCTTTCTGGCACACAGTAACACAGC -3'

Sequencing Primer
(F):5'- CTGGTAACCAGATTGCTTGGAAC -3'
(R):5'- CAGTAACACAGCCTCCCTC -3'
Posted On 2013-05-09