Mutagenetix > Incidental Mutation

Incidental Mutation 'R4715:Siglec1'

353924

Institutional Source

Beutler Lab

Gene Symbol

Siglec1

Ensembl Gene

ENSMUSG00000027322

Gene Name

sialic acid binding Ig-like lectin 1, sialoadhesin

Synonyms

Sn, CD169, Siglec-1

MMRRC Submission

041982-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R4715 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131069220-131086765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 131074436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1198 (D1198G)

Ref Sequence

ENSEMBL: ENSMUSP00000105856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000028794
AA Change: D1198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: D1198G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	9.4e-18	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART
IG_like	1549	1624	1.21e-1	SMART
transmembrane domain	1647	1669	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110227
AA Change: D1198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: D1198G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	7e-17	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART

Meta Mutation Damage Score

0.5932

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

92% (86/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	C	19: 43,816,882	E725A	possibly damaging	Het
Abcc5	G	T	16: 20,398,876	L362I	probably damaging	Het
Ammecr1l	C	T	18: 31,774,653	R179*	probably null	Het
Arap2	G	T	5: 62,749,094	T194K	probably benign	Het
Atf2	C	A	2: 73,823,300	V282F	probably damaging	Het
Atp1a1	T	C	3: 101,591,806	E159G	possibly damaging	Het
B4galt2	T	C	4: 117,877,179	S258G	possibly damaging	Het
Bptf	G	T	11: 107,047,181	H2695N	probably damaging	Het
Casq2	T	C	3: 102,110,244	V80A	probably benign	Het
Ccdc130	A	G	8: 84,263,874	I43T	probably damaging	Het
Cdc42ep3	G	A	17: 79,335,458	A11V	probably benign	Het
Cdh4	A	T	2: 179,780,467	H128L	probably benign	Het
Cdk5rap1	C	A	2: 154,361,835	*191L	probably null	Het
Cfdp1	G	A	8: 111,830,891	T206I	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Clpx	A	C	9: 65,312,114	R231S	possibly damaging	Het
Copg1	T	A	6: 87,912,286	L870*	probably null	Het
Cyp4a10	A	T	4: 115,525,338	D275V	probably benign	Het
Dip2a	T	C	10: 76,296,406	T504A	probably benign	Het
Dmxl2	A	C	9: 54,446,405		probably null	Het
Dnaaf5	A	T	5: 139,178,000	I671F	probably damaging	Het
Dnah14	A	G	1: 181,757,223	D3173G	probably damaging	Het
Dock2	T	C	11: 34,294,118	Y1074C	probably damaging	Het
Dthd1	A	C	5: 62,888,187	M765L	probably benign	Het
E2f3	A	C	13: 29,911,275	C220W	probably damaging	Het
Elf3	C	T	1: 135,257,752	S8N	probably damaging	Het
F2rl1	A	T	13: 95,513,267	V369E	probably damaging	Het
Fam214a	T	A	9: 75,012,968	W799R	probably damaging	Het
Fpr-rs7	C	T	17: 20,113,428	G267R	probably benign	Het
Ggact	A	T	14: 122,891,635	L56Q	possibly damaging	Het
Gm10698	A	T	9: 33,728,488		noncoding transcript	Het
Gm5546	T	C	3: 104,366,508		noncoding transcript	Het
Gm8267	A	G	14: 44,717,835	V243A	probably benign	Het
Gtf2h1	A	G	7: 46,815,412	T424A	possibly damaging	Het
Gucy1b2	A	G	14: 62,423,017	V140A	possibly damaging	Het
Htatip2	T	C	7: 49,770,844	L146P	probably damaging	Het
Htr1b	T	C	9: 81,631,510	D348G	possibly damaging	Het
Ifi205	T	C	1: 174,028,321	I48V	possibly damaging	Het
Igkv18-36	C	T	6: 69,992,591	R72K	probably damaging	Het
Kcnk7	T	C	19: 5,706,253	L169P	probably damaging	Het
Klf17	T	C	4: 117,760,536	D208G	probably benign	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Map4k4	G	A	1: 40,019,564	V1040I	probably damaging	Het
Mark1	A	G	1: 184,912,132	V445A	probably benign	Het
Med11	T	C	11: 70,453,196	I114T	probably benign	Het
Moxd2	A	G	6: 40,887,247	V83A	probably damaging	Het
Mrpl33	A	G	5: 31,616,358		probably benign	Het
Mrps27	A	G	13: 99,414,815		probably null	Het
Nop58	T	C	1: 59,696,026	V75A	probably benign	Het
Olfr1290	A	C	2: 111,489,744	M138R	probably benign	Het
Olfr1339	T	C	4: 118,734,655	L42P	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr325	A	G	11: 58,581,429	D195G	probably damaging	Het
Olfr832	A	G	9: 18,945,446	H266R	probably benign	Het
Olfr844	C	A	9: 19,319,147	F210L	probably benign	Het
Pdzd2	G	T	15: 12,419,516	N263K	possibly damaging	Het
Podnl1	C	A	8: 84,126,061		probably benign	Het
Prkd3	G	T	17: 78,951,937	H864N	possibly damaging	Het
Ptprd	T	C	4: 76,107,333	T543A	probably benign	Het
Pum2	T	A	12: 8,747,272	I788N	probably damaging	Het
Ralgapa1	T	A	12: 55,693,458	N1328I	probably damaging	Het
Rhoc	T	C	3: 104,794,039	L193P	probably damaging	Het
Rif1	T	C	2: 52,073,139		probably benign	Het
Rspo2	A	T	15: 43,075,904	C163*	probably null	Het
Sco1	A	G	11: 67,056,599	Y204C	probably damaging	Het
Shc2	T	C	10: 79,622,379	K490R	probably benign	Het
Slc25a18	T	C	6: 120,786,090	V31A	probably damaging	Het
Smpd5	A	T	15: 76,295,693	I112L	probably benign	Het
Synpr	CT	C	14: 13,285,198		probably null	Het
Tdrd9	T	G	12: 112,041,689	S988A	probably benign	Het
Tiam2	T	A	17: 3,454,168	F982I	probably damaging	Het
Tmc3	G	A	7: 83,622,396	V919I	probably benign	Het
Tmem200c	A	T	17: 68,840,470	D16V	probably damaging	Het
Tmem37	A	T	1: 120,068,205	D47E	probably damaging	Het
Top3a	T	A	11: 60,742,997	R733*	probably null	Het
Treh	T	C	9: 44,683,318	V8A	probably benign	Het
Trim17	A	C	11: 58,968,450		probably benign	Het
Ubash3b	T	C	9: 41,016,600	K471E	probably damaging	Het
Usp8	T	A	2: 126,729,222	L144Q	possibly damaging	Het
Wnk2	T	A	13: 49,147,232	M1L	unknown	Het

Other mutations in Siglec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Siglec1	APN	2	131079325	missense	probably benign	0.03
IGL01092:Siglec1	APN	2	131079217	missense	probably damaging	1.00
IGL01115:Siglec1	APN	2	131074502	missense	probably benign	0.01
IGL01324:Siglec1	APN	2	131085541	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131083536	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131075005	nonsense	probably null
IGL01558:Siglec1	APN	2	131078499	missense	probably damaging	0.96
IGL01632:Siglec1	APN	2	131083820	missense	probably benign	0.03
IGL01768:Siglec1	APN	2	131074394	missense	probably benign
IGL02399:Siglec1	APN	2	131071178	missense	probably benign	0.16
IGL02558:Siglec1	APN	2	131074995	missense	possibly damaging	0.88
IGL02794:Siglec1	APN	2	131075969	missense	possibly damaging	0.86
IGL02839:Siglec1	APN	2	131084932	missense	possibly damaging	0.82
aggressor	UTSW	2	131083941	nonsense	probably null
boris	UTSW	2	131079377	nonsense	probably null
espia	UTSW	2	131072744	missense	probably damaging	0.98
hoodlum	UTSW	2	131072747	missense	possibly damaging	0.88
microfische	UTSW	2	131086095	missense	possibly damaging	0.73
K3955:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
P0038:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
PIT4576001:Siglec1	UTSW	2	131078161	missense	probably damaging	1.00
PIT4677001:Siglec1	UTSW	2	131072757	missense	probably damaging	1.00
R0003:Siglec1	UTSW	2	131075060	missense	probably benign	0.00
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0243:Siglec1	UTSW	2	131085476	missense	probably damaging	1.00
R0276:Siglec1	UTSW	2	131083941	nonsense	probably null
R0379:Siglec1	UTSW	2	131074525	splice site	probably benign
R0464:Siglec1	UTSW	2	131079359	missense	probably damaging	1.00
R0507:Siglec1	UTSW	2	131074525	splice site	probably benign
R0560:Siglec1	UTSW	2	131070346	missense	probably benign	0.02
R0620:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0621:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0853:Siglec1	UTSW	2	131085022	missense	probably damaging	0.98
R1079:Siglec1	UTSW	2	131079377	nonsense	probably null
R1169:Siglec1	UTSW	2	131074827	missense	probably damaging	0.97
R1205:Siglec1	UTSW	2	131080464	missense	possibly damaging	0.94
R1293:Siglec1	UTSW	2	131073531	missense	probably benign	0.00
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1533:Siglec1	UTSW	2	131076158	missense	probably benign
R1717:Siglec1	UTSW	2	131073956	missense	possibly damaging	0.92
R1717:Siglec1	UTSW	2	131084012	missense	probably damaging	1.00
R1744:Siglec1	UTSW	2	131081299	missense	probably damaging	1.00
R1852:Siglec1	UTSW	2	131081500	missense	probably damaging	0.98
R1941:Siglec1	UTSW	2	131078131	missense	possibly damaging	0.94
R2011:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2012:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2128:Siglec1	UTSW	2	131080497	missense	probably damaging	1.00
R2278:Siglec1	UTSW	2	131071337	missense	probably benign	0.28
R2403:Siglec1	UTSW	2	131074475	missense	possibly damaging	0.65
R2449:Siglec1	UTSW	2	131078725	missense	probably benign	0.44
R2885:Siglec1	UTSW	2	131072747	missense	possibly damaging	0.88
R4213:Siglec1	UTSW	2	131074118	missense	probably damaging	1.00
R4274:Siglec1	UTSW	2	131085814	missense	probably benign	0.00
R4679:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R4782:Siglec1	UTSW	2	131075923	missense	probably damaging	1.00
R4896:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R4993:Siglec1	UTSW	2	131073361	missense	possibly damaging	0.93
R5004:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R5004:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R5105:Siglec1	UTSW	2	131080400	missense	possibly damaging	0.69
R5137:Siglec1	UTSW	2	131081344	missense	probably damaging	1.00
R5153:Siglec1	UTSW	2	131085577	missense	probably damaging	0.99
R5311:Siglec1	UTSW	2	131079316	missense	probably damaging	1.00
R5600:Siglec1	UTSW	2	131085583	missense	probably benign	0.01
R5682:Siglec1	UTSW	2	131084010	missense	probably damaging	1.00
R5732:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R5870:Siglec1	UTSW	2	131072847	missense	probably damaging	0.99
R5898:Siglec1	UTSW	2	131073633	missense	probably damaging	1.00
R5909:Siglec1	UTSW	2	131077964	missense	probably damaging	1.00
R6488:Siglec1	UTSW	2	131081307	missense	probably damaging	0.99
R6920:Siglec1	UTSW	2	131078077	nonsense	probably null
R7064:Siglec1	UTSW	2	131083914	missense	probably benign	0.00
R7270:Siglec1	UTSW	2	131081551	missense	possibly damaging	0.67
R7355:Siglec1	UTSW	2	131080451	missense	probably benign	0.02
R7400:Siglec1	UTSW	2	131086095	missense	possibly damaging	0.73
R7470:Siglec1	UTSW	2	131075824	missense	probably benign	0.00
R7568:Siglec1	UTSW	2	131072682	missense	probably damaging	1.00
R7781:Siglec1	UTSW	2	131081338	missense	probably damaging	1.00
R7853:Siglec1	UTSW	2	131081292	missense	probably damaging	1.00
R7999:Siglec1	UTSW	2	131071163	missense	probably benign	0.28
R8191:Siglec1	UTSW	2	131085679	missense	probably damaging	1.00
R8274:Siglec1	UTSW	2	131083910	missense	probably benign
R8345:Siglec1	UTSW	2	131078578	missense	possibly damaging	0.95
R8670:Siglec1	UTSW	2	131081467	missense	probably damaging	1.00
R8814:Siglec1	UTSW	2	131072744	missense	probably damaging	0.98
R9102:Siglec1	UTSW	2	131073469	missense	probably benign	0.01
R9311:Siglec1	UTSW	2	131074093	missense	probably damaging	1.00
R9416:Siglec1	UTSW	2	131083470	missense	probably benign	0.01
R9462:Siglec1	UTSW	2	131074484	missense	probably damaging	1.00
R9521:Siglec1	UTSW	2	131073326	critical splice donor site	probably null
X0024:Siglec1	UTSW	2	131080491	missense	probably damaging	1.00
Z1176:Siglec1	UTSW	2	131078745	missense	probably damaging	0.99
Z1176:Siglec1	UTSW	2	131080524	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATGACAGGCAGTTCCTTCCC -3'
(R):5'- GAAGGATGAGTCACCCATGG -3'

Sequencing Primer
(F):5'- TTCCAGCAGAAGTTCCAGGGAC -3'
(R):5'- GTCACCCATGGGCTAGACATTAG -3'

Posted On

2015-10-21