Mutagenetix > Incidental Mutations

Incidental Mutation 'R4715:Atp1a1'

353928

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

041982-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4715 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101591806 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 159 (E159G)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036493
AA Change: E159G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: E159G

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200347

Meta Mutation Damage Score

0.2000

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

92% (86/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	C	19: 43,816,882	E725A	possibly damaging	Het
Abcc5	G	T	16: 20,398,876	L362I	probably damaging	Het
Ammecr1l	C	T	18: 31,774,653	R179*	probably null	Het
Arap2	G	T	5: 62,749,094	T194K	probably benign	Het
Atf2	C	A	2: 73,823,300	V282F	probably damaging	Het
B4galt2	T	C	4: 117,877,179	S258G	possibly damaging	Het
Bptf	G	T	11: 107,047,181	H2695N	probably damaging	Het
Casq2	T	C	3: 102,110,244	V80A	probably benign	Het
Ccdc130	A	G	8: 84,263,874	I43T	probably damaging	Het
Cdc42ep3	G	A	17: 79,335,458	A11V	probably benign	Het
Cdh4	A	T	2: 179,780,467	H128L	probably benign	Het
Cdk5rap1	C	A	2: 154,361,835	*191L	probably null	Het
Cfdp1	G	A	8: 111,830,891	T206I	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Clpx	A	C	9: 65,312,114	R231S	possibly damaging	Het
Copg1	T	A	6: 87,912,286	L870*	probably null	Het
Cyp4a10	A	T	4: 115,525,338	D275V	probably benign	Het
Dip2a	T	C	10: 76,296,406	T504A	probably benign	Het
Dmxl2	A	C	9: 54,446,405		probably null	Het
Dnaaf5	A	T	5: 139,178,000	I671F	probably damaging	Het
Dnah14	A	G	1: 181,757,223	D3173G	probably damaging	Het
Dock2	T	C	11: 34,294,118	Y1074C	probably damaging	Het
Dthd1	A	C	5: 62,888,187	M765L	probably benign	Het
E2f3	A	C	13: 29,911,275	C220W	probably damaging	Het
Elf3	C	T	1: 135,257,752	S8N	probably damaging	Het
F2rl1	A	T	13: 95,513,267	V369E	probably damaging	Het
Fam214a	T	A	9: 75,012,968	W799R	probably damaging	Het
Fpr-rs7	C	T	17: 20,113,428	G267R	probably benign	Het
Ggact	A	T	14: 122,891,635	L56Q	possibly damaging	Het
Gm10698	A	T	9: 33,728,488		noncoding transcript	Het
Gm5546	T	C	3: 104,366,508		noncoding transcript	Het
Gm8267	A	G	14: 44,717,835	V243A	probably benign	Het
Gtf2h1	A	G	7: 46,815,412	T424A	possibly damaging	Het
Gucy1b2	A	G	14: 62,423,017	V140A	possibly damaging	Het
Htatip2	T	C	7: 49,770,844	L146P	probably damaging	Het
Htr1b	T	C	9: 81,631,510	D348G	possibly damaging	Het
Ifi205	T	C	1: 174,028,321	I48V	possibly damaging	Het
Igkv18-36	C	T	6: 69,992,591	R72K	probably damaging	Het
Kcnk7	T	C	19: 5,706,253	L169P	probably damaging	Het
Klf17	T	C	4: 117,760,536	D208G	probably benign	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Map4k4	G	A	1: 40,019,564	V1040I	probably damaging	Het
Mark1	A	G	1: 184,912,132	V445A	probably benign	Het
Med11	T	C	11: 70,453,196	I114T	probably benign	Het
Moxd2	A	G	6: 40,887,247	V83A	probably damaging	Het
Mrpl33	A	G	5: 31,616,358		probably benign	Het
Mrps27	A	G	13: 99,414,815		probably null	Het
Nop58	T	C	1: 59,696,026	V75A	probably benign	Het
Olfr1290	A	C	2: 111,489,744	M138R	probably benign	Het
Olfr1339	T	C	4: 118,734,655	L42P	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr325	A	G	11: 58,581,429	D195G	probably damaging	Het
Olfr832	A	G	9: 18,945,446	H266R	probably benign	Het
Olfr844	C	A	9: 19,319,147	F210L	probably benign	Het
Pdzd2	G	T	15: 12,419,516	N263K	possibly damaging	Het
Podnl1	C	A	8: 84,126,061		probably benign	Het
Prkd3	G	T	17: 78,951,937	H864N	possibly damaging	Het
Ptprd	T	C	4: 76,107,333	T543A	probably benign	Het
Pum2	T	A	12: 8,747,272	I788N	probably damaging	Het
Ralgapa1	T	A	12: 55,693,458	N1328I	probably damaging	Het
Rhoc	T	C	3: 104,794,039	L193P	probably damaging	Het
Rif1	T	C	2: 52,073,139		probably benign	Het
Rspo2	A	T	15: 43,075,904	C163*	probably null	Het
Sco1	A	G	11: 67,056,599	Y204C	probably damaging	Het
Shc2	T	C	10: 79,622,379	K490R	probably benign	Het
Siglec1	T	C	2: 131,074,436	D1198G	probably damaging	Het
Slc25a18	T	C	6: 120,786,090	V31A	probably damaging	Het
Smpd5	A	T	15: 76,295,693	I112L	probably benign	Het
Synpr	CT	C	14: 13,285,198		probably null	Het
Tdrd9	T	G	12: 112,041,689	S988A	probably benign	Het
Tiam2	T	A	17: 3,454,168	F982I	probably damaging	Het
Tmc3	G	A	7: 83,622,396	V919I	probably benign	Het
Tmem200c	A	T	17: 68,840,470	D16V	probably damaging	Het
Tmem37	A	T	1: 120,068,205	D47E	probably damaging	Het
Top3a	T	A	11: 60,742,997	R733*	probably null	Het
Treh	T	C	9: 44,683,318	V8A	probably benign	Het
Trim17	A	C	11: 58,968,450		probably benign	Het
Ubash3b	T	C	9: 41,016,600	K471E	probably damaging	Het
Usp8	T	A	2: 126,729,222	L144Q	possibly damaging	Het
Wnk2	T	A	13: 49,147,232	M1L	unknown	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGCAGCTCAACAGTTACCC -3'
(R):5'- CCACAGGCTCTAGAGGGATAAATG -3'

Sequencing Primer
(F):5'- TCAACAGTTACCCTAGGGCTG -3'
(R):5'- ATTCCTGAAGCTGTGGCC -3'

Posted On

2015-10-21