Incidental Mutation 'R4715:Cyp4a10'
ID353934
Institutional Source Beutler Lab
Gene Symbol Cyp4a10
Ensembl Gene ENSMUSG00000066072
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 10
SynonymsRP1, D4Rp1, Cyp4a
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4715 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115518264-115533649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115525338 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 275 (D275V)
Ref Sequence ENSEMBL: ENSMUSP00000061126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058785] [ENSMUST00000094886]
Predicted Effect probably benign
Transcript: ENSMUST00000058785
AA Change: D275V

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061126
Gene: ENSMUSG00000066072
AA Change: D275V

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 2.3e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094886
AA Change: D265V

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092486
Gene: ENSMUSG00000066072
AA Change: D265V

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:p450 51 494 4.5e-129 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display salt-sensitive hypertension, decrease sodium excretion, and decreased urine output. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Cyp4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00774:Cyp4a10 APN 4 115532538 missense probably damaging 1.00
IGL01301:Cyp4a10 APN 4 115518455 missense probably damaging 1.00
IGL02081:Cyp4a10 APN 4 115521172 missense possibly damaging 0.87
IGL02373:Cyp4a10 APN 4 115521077 nonsense probably null
IGL03411:Cyp4a10 APN 4 115525693 splice site probably null
ANU18:Cyp4a10 UTSW 4 115518455 missense probably damaging 1.00
PIT4142001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
PIT4151001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
R0016:Cyp4a10 UTSW 4 115521107 missense probably damaging 1.00
R0368:Cyp4a10 UTSW 4 115525377 nonsense probably null
R1319:Cyp4a10 UTSW 4 115521145 missense probably damaging 0.98
R1440:Cyp4a10 UTSW 4 115529449 missense probably damaging 1.00
R1531:Cyp4a10 UTSW 4 115518435 nonsense probably null
R2008:Cyp4a10 UTSW 4 115525392 missense probably damaging 0.98
R2064:Cyp4a10 UTSW 4 115524720 splice site probably benign
R2083:Cyp4a10 UTSW 4 115525308 missense possibly damaging 0.86
R2961:Cyp4a10 UTSW 4 115520270 missense probably benign 0.02
R3028:Cyp4a10 UTSW 4 115518431 missense possibly damaging 0.64
R3839:Cyp4a10 UTSW 4 115525347 missense possibly damaging 0.85
R3930:Cyp4a10 UTSW 4 115524783 missense probably benign 0.00
R4062:Cyp4a10 UTSW 4 115519701 missense probably benign 0.06
R4097:Cyp4a10 UTSW 4 115529283 missense probably damaging 0.99
R4298:Cyp4a10 UTSW 4 115532692 missense probably damaging 1.00
R4482:Cyp4a10 UTSW 4 115532598 missense probably damaging 1.00
R4592:Cyp4a10 UTSW 4 115529493 missense probably damaging 0.99
R4826:Cyp4a10 UTSW 4 115518344 missense probably benign 0.00
R4834:Cyp4a10 UTSW 4 115525808 missense probably damaging 1.00
R4922:Cyp4a10 UTSW 4 115521094 missense probably benign 0.01
R5202:Cyp4a10 UTSW 4 115532615 missense probably damaging 1.00
R5502:Cyp4a10 UTSW 4 115525505 missense probably benign 0.21
R6269:Cyp4a10 UTSW 4 115524312 missense probably damaging 1.00
R6349:Cyp4a10 UTSW 4 115525358 missense probably benign 0.00
R7684:Cyp4a10 UTSW 4 115518352 missense probably benign 0.18
R7863:Cyp4a10 UTSW 4 115518425 missense probably benign 0.00
R8392:Cyp4a10 UTSW 4 115529478 nonsense probably null
R8445:Cyp4a10 UTSW 4 115525594 missense probably damaging 1.00
Z1176:Cyp4a10 UTSW 4 115518326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCTAAAAGAGGTCTGACC -3'
(R):5'- GGTCCTTGTCAGACATGCTG -3'

Sequencing Primer
(F):5'- ATCAGATGTCACCAGTCTTCTAAC -3'
(R):5'- GTCCCCATTCTCCATCTCAGGG -3'
Posted On2015-10-21