Incidental Mutation 'R4715:B4galt2'
ID353936
Institutional Source Beutler Lab
Gene Symbol B4galt2
Ensembl Gene ENSMUSG00000028541
Gene NameUDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Synonyms
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R4715 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117869260-117883487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117877179 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 258 (S258G)
Ref Sequence ENSEMBL: ENSMUSP00000102029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030266] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000149168] [ENSMUST00000153358] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167443] [ENSMUST00000171052] [ENSMUST00000171548]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030266
AA Change: S258G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541
AA Change: S258G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084325
AA Change: S258G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541
AA Change: S258G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106421
AA Change: S258G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541
AA Change: S258G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137016
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153358
SMART Domains Protein: ENSMUSP00000120571
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 197 9.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164853
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170733
Predicted Effect probably benign
Transcript: ENSMUST00000171052
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171548
SMART Domains Protein: ENSMUSP00000126539
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.8603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased brain weight, ectopic Purkinje cells in the cerebellum, and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in B4galt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:B4galt2 APN 4 117877181 missense probably damaging 0.99
IGL02207:B4galt2 APN 4 117881521 missense probably damaging 1.00
IGL02224:B4galt2 APN 4 117876913 missense probably benign 0.00
IGL02724:B4galt2 APN 4 117876878 critical splice donor site probably null
IGL02949:B4galt2 APN 4 117881405 missense probably benign 0.05
R1164:B4galt2 UTSW 4 117876944 missense possibly damaging 0.96
R1534:B4galt2 UTSW 4 117877472 missense probably damaging 1.00
R5640:B4galt2 UTSW 4 117873998 missense probably benign
R6492:B4galt2 UTSW 4 117876967 missense probably damaging 0.99
R6974:B4galt2 UTSW 4 117873951 missense probably damaging 0.98
R7126:B4galt2 UTSW 4 117877538 missense probably damaging 1.00
Z1177:B4galt2 UTSW 4 117881069 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCGTGAGATCTTCATCCCAG -3'
(R):5'- AGTGAGACTCAGACCTACCC -3'

Sequencing Primer
(F):5'- GTGAGATCTTCATCCCAGTCAGG -3'
(R):5'- TGAGTCCCAGCCTCAGTC -3'
Posted On2015-10-21