Mutagenetix > Incidental Mutations

Incidental Mutation 'R4715:Arap2'

353939

Institutional Source

Beutler Lab

Gene Symbol

Arap2

Ensembl Gene

ENSMUSG00000037999

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Synonyms

Centd1

MMRRC Submission

041982-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4715 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62602445-62766159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 62749094 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 194 (T194K)

Ref Sequence

ENSEMBL: ENSMUSP00000075924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076623] [ENSMUST00000159470]

Predicted Effect

probably benign
Transcript: ENSMUST00000076623
AA Change: T194K

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: T194K

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART
low complexity region	222	233	N/A	INTRINSIC
PH	481	574	6.45e-17	SMART
PH	586	679	9.05e-12	SMART
ArfGap	684	805	9.2e-33	SMART
PH	891	1003	1.51e-8	SMART
PH	1013	1112	9.21e-4	SMART
RhoGAP	1124	1300	1.36e-50	SMART
Pfam:RA	1325	1416	2.1e-7	PFAM
PH	1429	1533	2.68e-14	SMART
coiled coil region	1561	1590	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159470

SMART Domains

Protein: ENSMUSP00000124743
Gene: ENSMUSG00000037999

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

92% (86/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	C	19: 43,816,882	E725A	possibly damaging	Het
Abcc5	G	T	16: 20,398,876	L362I	probably damaging	Het
Ammecr1l	C	T	18: 31,774,653	R179*	probably null	Het
Atf2	C	A	2: 73,823,300	V282F	probably damaging	Het
Atp1a1	T	C	3: 101,591,806	E159G	possibly damaging	Het
B4galt2	T	C	4: 117,877,179	S258G	possibly damaging	Het
Bptf	G	T	11: 107,047,181	H2695N	probably damaging	Het
Casq2	T	C	3: 102,110,244	V80A	probably benign	Het
Ccdc130	A	G	8: 84,263,874	I43T	probably damaging	Het
Cdc42ep3	G	A	17: 79,335,458	A11V	probably benign	Het
Cdh4	A	T	2: 179,780,467	H128L	probably benign	Het
Cdk5rap1	C	A	2: 154,361,835	*191L	probably null	Het
Cfdp1	G	A	8: 111,830,891	T206I	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Clpx	A	C	9: 65,312,114	R231S	possibly damaging	Het
Copg1	T	A	6: 87,912,286	L870*	probably null	Het
Cyp4a10	A	T	4: 115,525,338	D275V	probably benign	Het
Dip2a	T	C	10: 76,296,406	T504A	probably benign	Het
Dmxl2	A	C	9: 54,446,405		probably null	Het
Dnaaf5	A	T	5: 139,178,000	I671F	probably damaging	Het
Dnah14	A	G	1: 181,757,223	D3173G	probably damaging	Het
Dock2	T	C	11: 34,294,118	Y1074C	probably damaging	Het
Dthd1	A	C	5: 62,888,187	M765L	probably benign	Het
E2f3	A	C	13: 29,911,275	C220W	probably damaging	Het
Elf3	C	T	1: 135,257,752	S8N	probably damaging	Het
F2rl1	A	T	13: 95,513,267	V369E	probably damaging	Het
Fam214a	T	A	9: 75,012,968	W799R	probably damaging	Het
Fpr-rs7	C	T	17: 20,113,428	G267R	probably benign	Het
Ggact	A	T	14: 122,891,635	L56Q	possibly damaging	Het
Gm10698	A	T	9: 33,728,488		noncoding transcript	Het
Gm5546	T	C	3: 104,366,508		noncoding transcript	Het
Gm8267	A	G	14: 44,717,835	V243A	probably benign	Het
Gtf2h1	A	G	7: 46,815,412	T424A	possibly damaging	Het
Gucy1b2	A	G	14: 62,423,017	V140A	possibly damaging	Het
Htatip2	T	C	7: 49,770,844	L146P	probably damaging	Het
Htr1b	T	C	9: 81,631,510	D348G	possibly damaging	Het
Ifi205	T	C	1: 174,028,321	I48V	possibly damaging	Het
Igkv18-36	C	T	6: 69,992,591	R72K	probably damaging	Het
Kcnk7	T	C	19: 5,706,253	L169P	probably damaging	Het
Klf17	T	C	4: 117,760,536	D208G	probably benign	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Map4k4	G	A	1: 40,019,564	V1040I	probably damaging	Het
Mark1	A	G	1: 184,912,132	V445A	probably benign	Het
Med11	T	C	11: 70,453,196	I114T	probably benign	Het
Moxd2	A	G	6: 40,887,247	V83A	probably damaging	Het
Mrpl33	A	G	5: 31,616,358		probably benign	Het
Mrps27	A	G	13: 99,414,815		probably null	Het
Nop58	T	C	1: 59,696,026	V75A	probably benign	Het
Olfr1290	A	C	2: 111,489,744	M138R	probably benign	Het
Olfr1339	T	C	4: 118,734,655	L42P	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr325	A	G	11: 58,581,429	D195G	probably damaging	Het
Olfr832	A	G	9: 18,945,446	H266R	probably benign	Het
Olfr844	C	A	9: 19,319,147	F210L	probably benign	Het
Pdzd2	G	T	15: 12,419,516	N263K	possibly damaging	Het
Podnl1	C	A	8: 84,126,061		probably benign	Het
Prkd3	G	T	17: 78,951,937	H864N	possibly damaging	Het
Ptprd	T	C	4: 76,107,333	T543A	probably benign	Het
Pum2	T	A	12: 8,747,272	I788N	probably damaging	Het
Ralgapa1	T	A	12: 55,693,458	N1328I	probably damaging	Het
Rhoc	T	C	3: 104,794,039	L193P	probably damaging	Het
Rif1	T	C	2: 52,073,139		probably benign	Het
Rspo2	A	T	15: 43,075,904	C163*	probably null	Het
Sco1	A	G	11: 67,056,599	Y204C	probably damaging	Het
Shc2	T	C	10: 79,622,379	K490R	probably benign	Het
Siglec1	T	C	2: 131,074,436	D1198G	probably damaging	Het
Slc25a18	T	C	6: 120,786,090	V31A	probably damaging	Het
Smpd5	A	T	15: 76,295,693	I112L	probably benign	Het
Synpr	CT	C	14: 13,285,198		probably null	Het
Tdrd9	T	G	12: 112,041,689	S988A	probably benign	Het
Tiam2	T	A	17: 3,454,168	F982I	probably damaging	Het
Tmc3	G	A	7: 83,622,396	V919I	probably benign	Het
Tmem200c	A	T	17: 68,840,470	D16V	probably damaging	Het
Tmem37	A	T	1: 120,068,205	D47E	probably damaging	Het
Top3a	T	A	11: 60,742,997	R733*	probably null	Het
Treh	T	C	9: 44,683,318	V8A	probably benign	Het
Trim17	A	C	11: 58,968,450		probably benign	Het
Ubash3b	T	C	9: 41,016,600	K471E	probably damaging	Het
Usp8	T	A	2: 126,729,222	L144Q	possibly damaging	Het
Wnk2	T	A	13: 49,147,232	M1L	unknown	Het

Other mutations in Arap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Arap2	APN	5	62635962	missense	probably damaging	1.00
IGL00642:Arap2	APN	5	62733058	nonsense	probably null
IGL00705:Arap2	APN	5	62678023	missense	probably damaging	1.00
IGL00942:Arap2	APN	5	62698389	nonsense	probably null
IGL01069:Arap2	APN	5	62649856	missense	probably benign
IGL01601:Arap2	APN	5	62641342	missense	probably damaging	1.00
IGL01986:Arap2	APN	5	62621922	missense	probably damaging	1.00
IGL02032:Arap2	APN	5	62670997	missense	probably damaging	0.99
IGL02262:Arap2	APN	5	62642841	missense	probably damaging	1.00
IGL02331:Arap2	APN	5	62649682	splice site	probably benign
IGL02527:Arap2	APN	5	62749307	missense	probably benign
IGL02803:Arap2	APN	5	62749109	missense	probably benign
IGL02864:Arap2	APN	5	62677965	missense	probably damaging	1.00
IGL03078:Arap2	APN	5	62733065	splice site	probably benign
IGL03154:Arap2	APN	5	62642925	missense	probably damaging	1.00
IGL03213:Arap2	APN	5	62749095	missense	probably benign	0.00
IGL03279:Arap2	APN	5	62621910	missense	probably damaging	1.00
IGL03288:Arap2	APN	5	62604616	missense	probably benign	0.00
PIT4354001:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R0012:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0166:Arap2	UTSW	5	62676018	missense	probably damaging	1.00
R0472:Arap2	UTSW	5	62706659	missense	probably damaging	1.00
R0506:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0551:Arap2	UTSW	5	62641323	splice site	probably null
R0607:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0617:Arap2	UTSW	5	62649907	splice site	probably benign
R0975:Arap2	UTSW	5	62730886	splice site	probably benign
R0976:Arap2	UTSW	5	62649884	missense	probably damaging	1.00
R1164:Arap2	UTSW	5	62683477	missense	probably damaging	1.00
R1268:Arap2	UTSW	5	62730621	missense	probably benign	0.00
R1480:Arap2	UTSW	5	62669129	nonsense	probably null
R1502:Arap2	UTSW	5	62604404	missense	probably benign	0.00
R1543:Arap2	UTSW	5	62606155	nonsense	probably null
R1865:Arap2	UTSW	5	62698263	missense	probably damaging	0.97
R1962:Arap2	UTSW	5	62676664	missense	possibly damaging	0.82
R2040:Arap2	UTSW	5	62748916	missense	probably damaging	0.99
R2118:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2131:Arap2	UTSW	5	62677958	missense	probably damaging	1.00
R2201:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2215:Arap2	UTSW	5	62677176	missense	probably damaging	1.00
R3027:Arap2	UTSW	5	62669897	missense	probably damaging	1.00
R3053:Arap2	UTSW	5	62748857	missense	probably benign	0.35
R3975:Arap2	UTSW	5	62748894	missense	possibly damaging	0.87
R4272:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4273:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4326:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4327:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4328:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4451:Arap2	UTSW	5	62749170	missense	probably benign	0.06
R4659:Arap2	UTSW	5	62654126	missense	possibly damaging	0.94
R4665:Arap2	UTSW	5	62669969	missense	possibly damaging	0.95
R4808:Arap2	UTSW	5	62730641	missense	probably benign	0.23
R4941:Arap2	UTSW	5	62749478	missense	probably benign	0.20
R4983:Arap2	UTSW	5	62676525	missense	probably damaging	0.98
R5095:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R5156:Arap2	UTSW	5	62669181	nonsense	probably null
R5201:Arap2	UTSW	5	62683489	missense	probably damaging	1.00
R5346:Arap2	UTSW	5	62714746	missense	probably benign	0.39
R5359:Arap2	UTSW	5	62683419	nonsense	probably null
R5426:Arap2	UTSW	5	62642816	missense	probably benign	0.02
R5503:Arap2	UTSW	5	62630186	missense	probably damaging	1.00
R5605:Arap2	UTSW	5	62615067	missense	possibly damaging	0.47
R5764:Arap2	UTSW	5	62642854	missense	probably damaging	1.00
R5813:Arap2	UTSW	5	62677163	missense	probably damaging	1.00
R5846:Arap2	UTSW	5	62649773	missense	probably damaging	1.00
R6084:Arap2	UTSW	5	62670954	missense	possibly damaging	0.89
R6173:Arap2	UTSW	5	62749622	missense	probably damaging	1.00
R6175:Arap2	UTSW	5	62714731	critical splice donor site	probably null
R6249:Arap2	UTSW	5	62646193	missense	probably damaging	0.99
R6386:Arap2	UTSW	5	62604522	missense	possibly damaging	0.89
R6424:Arap2	UTSW	5	62683364	missense	probably damaging	1.00
R6744:Arap2	UTSW	5	62748938	missense	probably damaging	1.00
R6766:Arap2	UTSW	5	62677100	critical splice donor site	probably null
R6990:Arap2	UTSW	5	62676517	missense	probably damaging	0.96
R7067:Arap2	UTSW	5	62654044	critical splice donor site	probably null
R7098:Arap2	UTSW	5	62675950	critical splice donor site	probably null
R7107:Arap2	UTSW	5	62606208	missense	probably damaging	0.98
R7156:Arap2	UTSW	5	62604571	missense	probably damaging	1.00
R7174:Arap2	UTSW	5	62604278	missense	probably benign
R7187:Arap2	UTSW	5	62669053	missense	probably damaging	0.99
R7197:Arap2	UTSW	5	62641386	missense	possibly damaging	0.89
R7214:Arap2	UTSW	5	62749338	missense	probably benign	0.00
R7317:Arap2	UTSW	5	62649724	missense	probably damaging	1.00
R7392:Arap2	UTSW	5	62698385	missense	possibly damaging	0.54
R7438:Arap2	UTSW	5	62749475	missense	probably damaging	0.99
R7452:Arap2	UTSW	5	62676549	missense	probably benign	0.00
R7495:Arap2	UTSW	5	62676550	missense	possibly damaging	0.78
R7796:Arap2	UTSW	5	62730762	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCGCCCTGAAACTGAAAG -3'
(R):5'- CATTACTGTCCATAGACCTGGCC -3'

Sequencing Primer
(F):5'- CGCCCTGAAACTGAAAGAACGG -3'
(R):5'- TGAAGGAAACTGTCAGTCTCC -3'

Posted On

2015-10-21