Incidental Mutation 'R4715:Dnaaf5'
ID353941
Institutional Source Beutler Lab
Gene Symbol Dnaaf5
Ensembl Gene ENSMUSG00000025857
Gene Namedynein, axonemal assembly factor 5
SynonymsHeatr2
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R4715 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139150223-139186510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139178000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 671 (I671F)
Ref Sequence ENSEMBL: ENSMUSP00000026975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026975] [ENSMUST00000196441]
Predicted Effect probably damaging
Transcript: ENSMUST00000026975
AA Change: I671F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026975
Gene: ENSMUSG00000025857
AA Change: I671F

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 91 153 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
Pfam:Vac14_Fab1_bd 673 770 2.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127542
Predicted Effect probably damaging
Transcript: ENSMUST00000196441
AA Change: I376F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142924
Gene: ENSMUSG00000025857
AA Change: I376F

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 378 475 4.1e-5 PFAM
Pfam:HEAT 447 477 1.7e-3 PFAM
Meta Mutation Damage Score 0.8152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Dnaaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dnaaf5 APN 5 139177946 missense probably benign 0.19
IGL00730:Dnaaf5 APN 5 139151668 critical splice donor site probably null
IGL01468:Dnaaf5 APN 5 139151480 splice site probably null
IGL02106:Dnaaf5 APN 5 139151513 missense probably damaging 1.00
IGL02273:Dnaaf5 APN 5 139177916 nonsense probably null
IGL02514:Dnaaf5 APN 5 139174117 splice site probably benign
IGL02572:Dnaaf5 APN 5 139184629 missense probably benign 0.00
IGL02699:Dnaaf5 APN 5 139153350 splice site probably benign
PIT4142001:Dnaaf5 UTSW 5 139185518 missense possibly damaging 0.91
PIT4283001:Dnaaf5 UTSW 5 139166162 missense probably benign 0.26
R0458:Dnaaf5 UTSW 5 139161878 missense possibly damaging 0.47
R2060:Dnaaf5 UTSW 5 139178003 missense probably damaging 1.00
R2162:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3833:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3944:Dnaaf5 UTSW 5 139152924 start gained probably benign
R4438:Dnaaf5 UTSW 5 139163392 missense probably damaging 1.00
R4534:Dnaaf5 UTSW 5 139151527 nonsense probably null
R4576:Dnaaf5 UTSW 5 139185639 missense probably damaging 0.98
R4581:Dnaaf5 UTSW 5 139184685 missense probably damaging 1.00
R4791:Dnaaf5 UTSW 5 139184650 missense possibly damaging 0.56
R4868:Dnaaf5 UTSW 5 139170186 missense probably benign 0.01
R5011:Dnaaf5 UTSW 5 139163257 missense probably damaging 1.00
R5074:Dnaaf5 UTSW 5 139174207 missense probably damaging 1.00
R5137:Dnaaf5 UTSW 5 139181460 missense probably damaging 1.00
R5215:Dnaaf5 UTSW 5 139161877 missense probably benign 0.00
R5309:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R5312:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R6632:Dnaaf5 UTSW 5 139170333 missense probably benign 0.04
R6863:Dnaaf5 UTSW 5 139151596 missense probably damaging 0.96
R7292:Dnaaf5 UTSW 5 139150317 missense unknown
R7439:Dnaaf5 UTSW 5 139166113 missense probably damaging 1.00
R7571:Dnaaf5 UTSW 5 139170208 missense possibly damaging 0.73
R7679:Dnaaf5 UTSW 5 139150637 missense unknown
R7706:Dnaaf5 UTSW 5 139152841 missense probably damaging 1.00
R7867:Dnaaf5 UTSW 5 139161810 missense probably damaging 1.00
R8191:Dnaaf5 UTSW 5 139181495 missense probably benign 0.06
R8354:Dnaaf5 UTSW 5 139161859 frame shift probably null
R8355:Dnaaf5 UTSW 5 139161859 frame shift probably null
X0020:Dnaaf5 UTSW 5 139163320 missense probably damaging 0.99
Z1177:Dnaaf5 UTSW 5 139177975 missense probably damaging 1.00
Z1177:Dnaaf5 UTSW 5 139185542 missense probably benign 0.04
Z1177:Dnaaf5 UTSW 5 139185585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCATGGTTGGTGCAGCCC -3'
(R):5'- ACAGACTTCAGCCCTTTAGAGC -3'

Sequencing Primer
(F):5'- CTGAAACCACCTTGTGCAGAGG -3'
(R):5'- AGAGCTTTCTGTGCTGATTGAATGAC -3'
Posted On2015-10-21