Incidental Mutation 'R4715:Cfdp1'
ID 353952
Institutional Source Beutler Lab
Gene Symbol Cfdp1
Ensembl Gene ENSMUSG00000031954
Gene Name craniofacial development protein 1
Synonyms cp27, Bcnt, Bucentaur
MMRRC Submission 041982-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.903) question?
Stock # R4715 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 112495123-112580923 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 112557523 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 206 (T206I)
Ref Sequence ENSEMBL: ENSMUSP00000034432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034432]
AlphaFold O88271
Predicted Effect probably benign
Transcript: ENSMUST00000034432
AA Change: T206I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000034432
Gene: ENSMUSG00000031954
AA Change: T206I

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 66 99 N/A INTRINSIC
Pfam:BCNT 217 291 5e-34 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,805,321 (GRCm39) E725A possibly damaging Het
Abcc5 G T 16: 20,217,626 (GRCm39) L362I probably damaging Het
Ammecr1l C T 18: 31,907,706 (GRCm39) R179* probably null Het
Arap2 G T 5: 62,906,437 (GRCm39) T194K probably benign Het
Atf2 C A 2: 73,653,644 (GRCm39) V282F probably damaging Het
Atosa T A 9: 74,920,250 (GRCm39) W799R probably damaging Het
Atp1a1 T C 3: 101,499,122 (GRCm39) E159G possibly damaging Het
B4galt2 T C 4: 117,734,376 (GRCm39) S258G possibly damaging Het
Bptf G T 11: 106,938,007 (GRCm39) H2695N probably damaging Het
Casq2 T C 3: 102,017,560 (GRCm39) V80A probably benign Het
Cdc42ep3 G A 17: 79,642,887 (GRCm39) A11V probably benign Het
Cdh4 A T 2: 179,422,260 (GRCm39) H128L probably benign Het
Cdk5rap1 C A 2: 154,203,755 (GRCm39) *191L probably null Het
Cgn C A 3: 94,686,748 (GRCm39) G185W probably damaging Het
Clpx A C 9: 65,219,396 (GRCm39) R231S possibly damaging Het
Copg1 T A 6: 87,889,268 (GRCm39) L870* probably null Het
Cyp4a10 A T 4: 115,382,535 (GRCm39) D275V probably benign Het
Dip2a T C 10: 76,132,240 (GRCm39) T504A probably benign Het
Dmxl2 A C 9: 54,353,689 (GRCm39) probably null Het
Dnaaf5 A T 5: 139,163,755 (GRCm39) I671F probably damaging Het
Dnah14 A G 1: 181,584,788 (GRCm39) D3173G probably damaging Het
Dock2 T C 11: 34,244,118 (GRCm39) Y1074C probably damaging Het
Dthd1 A C 5: 63,045,530 (GRCm39) M765L probably benign Het
E2f3 A C 13: 30,095,258 (GRCm39) C220W probably damaging Het
Elf3 C T 1: 135,185,490 (GRCm39) S8N probably damaging Het
F2rl1 A T 13: 95,649,775 (GRCm39) V369E probably damaging Het
Fpr-rs7 C T 17: 20,333,690 (GRCm39) G267R probably benign Het
Ggact A T 14: 123,129,047 (GRCm39) L56Q possibly damaging Het
Gm5546 T C 3: 104,273,824 (GRCm39) noncoding transcript Het
Gm8267 A G 14: 44,955,292 (GRCm39) V243A probably benign Het
Gtf2h1 A G 7: 46,464,836 (GRCm39) T424A possibly damaging Het
Gucy1b2 A G 14: 62,660,466 (GRCm39) V140A possibly damaging Het
Htatip2 T C 7: 49,420,592 (GRCm39) L146P probably damaging Het
Htr1b T C 9: 81,513,563 (GRCm39) D348G possibly damaging Het
Ifi205 T C 1: 173,855,887 (GRCm39) I48V possibly damaging Het
Igkv18-36 C T 6: 69,969,575 (GRCm39) R72K probably damaging Het
Kcnk7 T C 19: 5,756,281 (GRCm39) L169P probably damaging Het
Klf17 T C 4: 117,617,733 (GRCm39) D208G probably benign Het
Ltn1 A G 16: 87,215,382 (GRCm39) F418L probably damaging Het
Map4k4 G A 1: 40,058,724 (GRCm39) V1040I probably damaging Het
Mark1 A G 1: 184,644,329 (GRCm39) V445A probably benign Het
Med11 T C 11: 70,344,022 (GRCm39) I114T probably benign Het
Moxd2 A G 6: 40,864,181 (GRCm39) V83A probably damaging Het
Mrpl33 A G 5: 31,773,702 (GRCm39) probably benign Het
Mrps27 A G 13: 99,551,323 (GRCm39) probably null Het
Nop58 T C 1: 59,735,185 (GRCm39) V75A probably benign Het
Or13p5 T C 4: 118,591,852 (GRCm39) L42P probably damaging Het
Or2n1d A C 17: 38,646,731 (GRCm39) I228L possibly damaging Het
Or2t46 A G 11: 58,472,255 (GRCm39) D195G probably damaging Het
Or4k42 A C 2: 111,320,089 (GRCm39) M138R probably benign Het
Or7g19 A G 9: 18,856,742 (GRCm39) H266R probably benign Het
Or7g26 C A 9: 19,230,443 (GRCm39) F210L probably benign Het
Pdzd2 G T 15: 12,419,602 (GRCm39) N263K possibly damaging Het
Podnl1 C A 8: 84,852,690 (GRCm39) probably benign Het
Prkd3 G T 17: 79,259,366 (GRCm39) H864N possibly damaging Het
Ptprd T C 4: 76,025,570 (GRCm39) T543A probably benign Het
Pum2 T A 12: 8,797,272 (GRCm39) I788N probably damaging Het
Ralgapa1 T A 12: 55,740,243 (GRCm39) N1328I probably damaging Het
Rhoc T C 3: 104,701,355 (GRCm39) L193P probably damaging Het
Rif1 T C 2: 51,963,151 (GRCm39) probably benign Het
Rspo2 A T 15: 42,939,300 (GRCm39) C163* probably null Het
Sco1 A G 11: 66,947,425 (GRCm39) Y204C probably damaging Het
Shc2 T C 10: 79,458,213 (GRCm39) K490R probably benign Het
Siglec1 T C 2: 130,916,356 (GRCm39) D1198G probably damaging Het
Slc25a18 T C 6: 120,763,051 (GRCm39) V31A probably damaging Het
Smpd5 A T 15: 76,179,893 (GRCm39) I112L probably benign Het
Synpr CT C 14: 13,285,198 (GRCm38) probably null Het
Tdrd9 T G 12: 112,008,123 (GRCm39) S988A probably benign Het
Tiam2 T A 17: 3,504,443 (GRCm39) F982I probably damaging Het
Tmc3 G A 7: 83,271,604 (GRCm39) V919I probably benign Het
Tmed2b A T 9: 33,639,784 (GRCm39) noncoding transcript Het
Tmem200c A T 17: 69,147,465 (GRCm39) D16V probably damaging Het
Tmem37 A T 1: 119,995,935 (GRCm39) D47E probably damaging Het
Top3a T A 11: 60,633,823 (GRCm39) R733* probably null Het
Treh T C 9: 44,594,615 (GRCm39) V8A probably benign Het
Trim17 A C 11: 58,859,276 (GRCm39) probably benign Het
Ubash3b T C 9: 40,927,896 (GRCm39) K471E probably damaging Het
Usp8 T A 2: 126,571,142 (GRCm39) L144Q possibly damaging Het
Wnk2 T A 13: 49,300,708 (GRCm39) M1L unknown Het
Yju2b A G 8: 84,990,503 (GRCm39) I43T probably damaging Het
Other mutations in Cfdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cfdp1 APN 8 112,567,110 (GRCm39) missense probably benign 0.00
IGL02754:Cfdp1 APN 8 112,580,766 (GRCm39) splice site probably benign
R0060:Cfdp1 UTSW 8 112,566,986 (GRCm39) splice site probably benign
R1900:Cfdp1 UTSW 8 112,495,361 (GRCm39) nonsense probably null
R4273:Cfdp1 UTSW 8 112,495,417 (GRCm39) missense probably damaging 1.00
R4661:Cfdp1 UTSW 8 112,557,577 (GRCm39) missense probably benign 0.19
R4662:Cfdp1 UTSW 8 112,557,577 (GRCm39) missense probably benign 0.19
R5265:Cfdp1 UTSW 8 112,557,617 (GRCm39) missense probably benign 0.30
R5388:Cfdp1 UTSW 8 112,495,384 (GRCm39) missense probably damaging 1.00
R7917:Cfdp1 UTSW 8 112,567,033 (GRCm39) missense possibly damaging 0.76
R8212:Cfdp1 UTSW 8 112,571,815 (GRCm39) missense probably damaging 0.97
R9621:Cfdp1 UTSW 8 112,571,807 (GRCm39) missense probably damaging 0.99
R9760:Cfdp1 UTSW 8 112,495,415 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTCTAGCAAACTCCATCTGGG -3'
(R):5'- GTACATTGGAATTGCTGGCATG -3'

Sequencing Primer
(F):5'- GGGTAAATAAATACTTCTGTCAAGGC -3'
(R):5'- CCTTTAGAGCTGCAGTTACAGACAG -3'
Posted On 2015-10-21