Incidental Mutation 'R4715:Clpx'
ID353958
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Namecaseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4715 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65294260-65330658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65312114 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 231 (R231S)
Ref Sequence ENSEMBL: ENSMUSP00000015501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015501
AA Change: R231S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: R231S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113824
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147279
SMART Domains Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
AAA 100 192 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148632
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65324270 missense probably damaging 1.00
IGL01394:Clpx APN 9 65310213 missense probably damaging 1.00
IGL01395:Clpx APN 9 65301851 missense probably benign 0.00
IGL01521:Clpx APN 9 65318744 missense probably damaging 1.00
IGL02141:Clpx APN 9 65312118 splice site probably null
IGL02512:Clpx APN 9 65310251 missense probably benign
IGL03008:Clpx APN 9 65322775 missense possibly damaging 0.76
IGL03146:Clpx APN 9 65326830 missense probably benign 0.01
IGL03152:Clpx APN 9 65310176 missense possibly damaging 0.56
IGL03309:Clpx APN 9 65322692 missense probably damaging 1.00
kneehigh UTSW 9 65301879 nonsense probably null
locust UTSW 9 65324301 critical splice donor site probably null
IGL02837:Clpx UTSW 9 65324259 missense probably damaging 1.00
R0167:Clpx UTSW 9 65316737 missense possibly damaging 0.53
R0399:Clpx UTSW 9 65322769 missense probably benign 0.03
R0666:Clpx UTSW 9 65310225 missense probably damaging 1.00
R1386:Clpx UTSW 9 65326888 missense probably null 0.88
R1594:Clpx UTSW 9 65324270 missense probably damaging 0.99
R2038:Clpx UTSW 9 65317493 missense probably damaging 1.00
R4131:Clpx UTSW 9 65316655 missense possibly damaging 0.64
R5107:Clpx UTSW 9 65308539 missense possibly damaging 0.93
R5248:Clpx UTSW 9 65320850 missense probably damaging 1.00
R5520:Clpx UTSW 9 65317448 nonsense probably null
R5639:Clpx UTSW 9 65329830 missense probably benign 0.00
R5718:Clpx UTSW 9 65299964 missense probably benign
R6109:Clpx UTSW 9 65299952 missense probably benign 0.02
R6172:Clpx UTSW 9 65301879 nonsense probably null
R6173:Clpx UTSW 9 65301879 nonsense probably null
R6748:Clpx UTSW 9 65310159 missense probably benign 0.00
R7287:Clpx UTSW 9 65300013 nonsense probably null
R7409:Clpx UTSW 9 65324247 missense possibly damaging 0.94
R7806:Clpx UTSW 9 65299931 missense probably benign
R7814:Clpx UTSW 9 65324301 critical splice donor site probably null
R8212:Clpx UTSW 9 65320891 missense possibly damaging 0.46
X0067:Clpx UTSW 9 65316695 missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65299997 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTATGAGTACCTGGGCAAC -3'
(R):5'- CCCTTATTCCAAAGTTACATACTGC -3'

Sequencing Primer
(F):5'- GAGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- CTGCATATGAAAGAGACATTTCAATG -3'
Posted On2015-10-21