Mutagenetix > Incidental Mutations

Incidental Mutation 'R4715:Clpx'

353958

Institutional Source

Beutler Lab

Gene Symbol

Clpx

Ensembl Gene

ENSMUSG00000015357

Gene Name

caseinolytic mitochondrial matrix peptidase chaperone subunit

Synonyms

MMRRC Submission

041982-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4715 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65294260-65330658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 65312114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 231 (R231S)

Ref Sequence

ENSEMBL: ENSMUSP00000015501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]

AlphaFold

Q9JHS4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015501
AA Change: R231S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: R231S

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
PDB:4I9K\|B	173	209	6e-7	PDB
low complexity region	259	268	N/A	INTRINSIC
AAA	286	437	1.64e-12	SMART
low complexity region	452	458	N/A	INTRINSIC
ClpB_D2-small	510	604	1.16e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113824

SMART Domains

Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
low complexity region	245	254	N/A	INTRINSIC
AAA	272	423	1.64e-12	SMART
low complexity region	438	444	N/A	INTRINSIC
ClpB_D2-small	496	590	1.16e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147279

SMART Domains

Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
AAA	100	192	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148632

Meta Mutation Damage Score

0.0704

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

92% (86/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	C	19: 43,816,882	E725A	possibly damaging	Het
Abcc5	G	T	16: 20,398,876	L362I	probably damaging	Het
Ammecr1l	C	T	18: 31,774,653	R179*	probably null	Het
Arap2	G	T	5: 62,749,094	T194K	probably benign	Het
Atf2	C	A	2: 73,823,300	V282F	probably damaging	Het
Atp1a1	T	C	3: 101,591,806	E159G	possibly damaging	Het
B4galt2	T	C	4: 117,877,179	S258G	possibly damaging	Het
Bptf	G	T	11: 107,047,181	H2695N	probably damaging	Het
Casq2	T	C	3: 102,110,244	V80A	probably benign	Het
Ccdc130	A	G	8: 84,263,874	I43T	probably damaging	Het
Cdc42ep3	G	A	17: 79,335,458	A11V	probably benign	Het
Cdh4	A	T	2: 179,780,467	H128L	probably benign	Het
Cdk5rap1	C	A	2: 154,361,835	*191L	probably null	Het
Cfdp1	G	A	8: 111,830,891	T206I	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Copg1	T	A	6: 87,912,286	L870*	probably null	Het
Cyp4a10	A	T	4: 115,525,338	D275V	probably benign	Het
Dip2a	T	C	10: 76,296,406	T504A	probably benign	Het
Dmxl2	A	C	9: 54,446,405		probably null	Het
Dnaaf5	A	T	5: 139,178,000	I671F	probably damaging	Het
Dnah14	A	G	1: 181,757,223	D3173G	probably damaging	Het
Dock2	T	C	11: 34,294,118	Y1074C	probably damaging	Het
Dthd1	A	C	5: 62,888,187	M765L	probably benign	Het
E2f3	A	C	13: 29,911,275	C220W	probably damaging	Het
Elf3	C	T	1: 135,257,752	S8N	probably damaging	Het
F2rl1	A	T	13: 95,513,267	V369E	probably damaging	Het
Fam214a	T	A	9: 75,012,968	W799R	probably damaging	Het
Fpr-rs7	C	T	17: 20,113,428	G267R	probably benign	Het
Ggact	A	T	14: 122,891,635	L56Q	possibly damaging	Het
Gm10698	A	T	9: 33,728,488		noncoding transcript	Het
Gm5546	T	C	3: 104,366,508		noncoding transcript	Het
Gm8267	A	G	14: 44,717,835	V243A	probably benign	Het
Gtf2h1	A	G	7: 46,815,412	T424A	possibly damaging	Het
Gucy1b2	A	G	14: 62,423,017	V140A	possibly damaging	Het
Htatip2	T	C	7: 49,770,844	L146P	probably damaging	Het
Htr1b	T	C	9: 81,631,510	D348G	possibly damaging	Het
Ifi205	T	C	1: 174,028,321	I48V	possibly damaging	Het
Igkv18-36	C	T	6: 69,992,591	R72K	probably damaging	Het
Kcnk7	T	C	19: 5,706,253	L169P	probably damaging	Het
Klf17	T	C	4: 117,760,536	D208G	probably benign	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Map4k4	G	A	1: 40,019,564	V1040I	probably damaging	Het
Mark1	A	G	1: 184,912,132	V445A	probably benign	Het
Med11	T	C	11: 70,453,196	I114T	probably benign	Het
Moxd2	A	G	6: 40,887,247	V83A	probably damaging	Het
Mrpl33	A	G	5: 31,616,358		probably benign	Het
Mrps27	A	G	13: 99,414,815		probably null	Het
Nop58	T	C	1: 59,696,026	V75A	probably benign	Het
Olfr1290	A	C	2: 111,489,744	M138R	probably benign	Het
Olfr1339	T	C	4: 118,734,655	L42P	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr325	A	G	11: 58,581,429	D195G	probably damaging	Het
Olfr832	A	G	9: 18,945,446	H266R	probably benign	Het
Olfr844	C	A	9: 19,319,147	F210L	probably benign	Het
Pdzd2	G	T	15: 12,419,516	N263K	possibly damaging	Het
Podnl1	C	A	8: 84,126,061		probably benign	Het
Prkd3	G	T	17: 78,951,937	H864N	possibly damaging	Het
Ptprd	T	C	4: 76,107,333	T543A	probably benign	Het
Pum2	T	A	12: 8,747,272	I788N	probably damaging	Het
Ralgapa1	T	A	12: 55,693,458	N1328I	probably damaging	Het
Rhoc	T	C	3: 104,794,039	L193P	probably damaging	Het
Rif1	T	C	2: 52,073,139		probably benign	Het
Rspo2	A	T	15: 43,075,904	C163*	probably null	Het
Sco1	A	G	11: 67,056,599	Y204C	probably damaging	Het
Shc2	T	C	10: 79,622,379	K490R	probably benign	Het
Siglec1	T	C	2: 131,074,436	D1198G	probably damaging	Het
Slc25a18	T	C	6: 120,786,090	V31A	probably damaging	Het
Smpd5	A	T	15: 76,295,693	I112L	probably benign	Het
Synpr	CT	C	14: 13,285,198		probably null	Het
Tdrd9	T	G	12: 112,041,689	S988A	probably benign	Het
Tiam2	T	A	17: 3,454,168	F982I	probably damaging	Het
Tmc3	G	A	7: 83,622,396	V919I	probably benign	Het
Tmem200c	A	T	17: 68,840,470	D16V	probably damaging	Het
Tmem37	A	T	1: 120,068,205	D47E	probably damaging	Het
Top3a	T	A	11: 60,742,997	R733*	probably null	Het
Treh	T	C	9: 44,683,318	V8A	probably benign	Het
Trim17	A	C	11: 58,968,450		probably benign	Het
Ubash3b	T	C	9: 41,016,600	K471E	probably damaging	Het
Usp8	T	A	2: 126,729,222	L144Q	possibly damaging	Het
Wnk2	T	A	13: 49,147,232	M1L	unknown	Het

Other mutations in Clpx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Clpx	APN	9	65324270	missense	probably damaging	1.00
IGL01394:Clpx	APN	9	65310213	missense	probably damaging	1.00
IGL01395:Clpx	APN	9	65301851	missense	probably benign	0.00
IGL01521:Clpx	APN	9	65318744	missense	probably damaging	1.00
IGL02141:Clpx	APN	9	65312118	splice site	probably null
IGL02512:Clpx	APN	9	65310251	missense	probably benign
IGL03008:Clpx	APN	9	65322775	missense	possibly damaging	0.76
IGL03146:Clpx	APN	9	65326830	missense	probably benign	0.01
IGL03152:Clpx	APN	9	65310176	missense	possibly damaging	0.56
IGL03309:Clpx	APN	9	65322692	missense	probably damaging	1.00
kneehigh	UTSW	9	65301879	nonsense	probably null
locust	UTSW	9	65324301	critical splice donor site	probably null
IGL02837:Clpx	UTSW	9	65324259	missense	probably damaging	1.00
R0167:Clpx	UTSW	9	65316737	missense	possibly damaging	0.53
R0399:Clpx	UTSW	9	65322769	missense	probably benign	0.03
R0666:Clpx	UTSW	9	65310225	missense	probably damaging	1.00
R1386:Clpx	UTSW	9	65326888	missense	probably null	0.88
R1594:Clpx	UTSW	9	65324270	missense	probably damaging	0.99
R2038:Clpx	UTSW	9	65317493	missense	probably damaging	1.00
R4131:Clpx	UTSW	9	65316655	missense	possibly damaging	0.64
R5107:Clpx	UTSW	9	65308539	missense	possibly damaging	0.93
R5248:Clpx	UTSW	9	65320850	missense	probably damaging	1.00
R5520:Clpx	UTSW	9	65317448	nonsense	probably null
R5639:Clpx	UTSW	9	65329830	missense	probably benign	0.00
R5718:Clpx	UTSW	9	65299964	missense	probably benign
R6109:Clpx	UTSW	9	65299952	missense	probably benign	0.02
R6172:Clpx	UTSW	9	65301879	nonsense	probably null
R6173:Clpx	UTSW	9	65301879	nonsense	probably null
R6748:Clpx	UTSW	9	65310159	missense	probably benign	0.00
R7287:Clpx	UTSW	9	65300013	nonsense	probably null
R7409:Clpx	UTSW	9	65324247	missense	possibly damaging	0.94
R7806:Clpx	UTSW	9	65299931	missense	probably benign
R7814:Clpx	UTSW	9	65324301	critical splice donor site	probably null
R8212:Clpx	UTSW	9	65320891	missense	possibly damaging	0.46
R8753:Clpx	UTSW	9	65316676	missense	probably damaging	1.00
R8939:Clpx	UTSW	9	65324237	missense	probably benign	0.00
R9023:Clpx	UTSW	9	65326833	missense	probably null	0.00
X0067:Clpx	UTSW	9	65316695	missense	possibly damaging	0.86
Z1177:Clpx	UTSW	9	65299997	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGACTATGAGTACCTGGGCAAC -3'
(R):5'- CCCTTATTCCAAAGTTACATACTGC -3'

Sequencing Primer
(F):5'- GAGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- CTGCATATGAAAGAGACATTTCAATG -3'

Posted On

2015-10-21