Incidental Mutation 'R4715:Sco1'
ID 353969
Institutional Source Beutler Lab
Gene Symbol Sco1
Ensembl Gene ENSMUSG00000069844
Gene Name SCO1 cytochrome c oxidase assembly protein
Synonyms D11Bwg1310e, 2610001C07Rik
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4715 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 67052670-67067070 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67056599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 204 (Y204C)
Ref Sequence ENSEMBL: ENSMUSP00000104330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092996] [ENSMUST00000108690] [ENSMUST00000116363] [ENSMUST00000146338]
AlphaFold Q5SUC9
Predicted Effect probably damaging
Transcript: ENSMUST00000092996
AA Change: Y199C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090673
Gene: ENSMUSG00000069844
AA Change: Y199C

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:SCO1-SenC 81 265 1.5e-48 PFAM
Pfam:AhpC-TSA 118 250 9.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108690
AA Change: Y204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104330
Gene: ENSMUSG00000069844
AA Change: Y204C

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:SCO1-SenC 91 270 2.4e-49 PFAM
Pfam:AhpC-TSA 125 254 7.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116363
SMART Domains Protein: ENSMUSP00000112064
Gene: ENSMUSG00000020910

DomainStartEndE-ValueType
Pfam:Metallophos 18 282 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137779
Predicted Effect probably benign
Transcript: ENSMUST00000146338
SMART Domains Protein: ENSMUSP00000137768
Gene: ENSMUSG00000020910

DomainStartEndE-ValueType
PDB:2NXF|A 13 199 4e-47 PDB
SCOP:d1utea_ 15 176 3e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148379
Meta Mutation Damage Score 0.9692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian cytochrome c oxidase (COX) catalyzes the transfer of reducing equivalents from cytochrome c to molecular oxygen and pumps protons across the inner mitochondrial membrane. In yeast, 2 related COX assembly genes, SCO1 and SCO2 (synthesis of cytochrome c oxidase), enable subunits 1 and 2 to be incorporated into the holoprotein. This gene is the human homolog to the yeast SCO1 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver exhibit weight loss, premature death, spleen atrophy, reduced white blood cells, increased mitochondria proliferation, increased iron levels in the liver and spleen, and decreased copper levels in the liver and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Sco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Sco1 APN 11 67064038 makesense probably null
IGL01765:Sco1 APN 11 67053790 missense probably damaging 1.00
IGL03103:Sco1 APN 11 67055742 nonsense probably null
R2929:Sco1 UTSW 11 67063922 missense probably damaging 1.00
R3831:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R3832:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R3833:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R4019:Sco1 UTSW 11 67064020 missense probably benign
R4020:Sco1 UTSW 11 67064020 missense probably benign
R4299:Sco1 UTSW 11 67055800 missense possibly damaging 0.84
R4541:Sco1 UTSW 11 67052842 missense probably benign 0.00
R5411:Sco1 UTSW 11 67063958 missense probably damaging 1.00
R6344:Sco1 UTSW 11 67055745 missense probably damaging 1.00
R7026:Sco1 UTSW 11 67053857 missense probably damaging 1.00
R7798:Sco1 UTSW 11 67053802 missense possibly damaging 0.67
R7819:Sco1 UTSW 11 67058393 missense probably damaging 1.00
Z1176:Sco1 UTSW 11 67063936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGTAGAACTGTTTTCCCCAG -3'
(R):5'- AAGTGCCGTTAGCTCCTGTG -3'

Sequencing Primer
(F):5'- AGAACTGTTTTCCCCAGGTATTG -3'
(R):5'- AGAGAAACCTGCTTCTTGCG -3'
Posted On 2015-10-21