Incidental Mutation 'R4715:Pum2'
ID353972
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Namepumilio RNA-binding family member 2
Synonyms5730503J23Rik, Pumm2
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4715 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location8674134-8752581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8747272 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 788 (I788N)
Ref Sequence ENSEMBL: ENSMUSP00000137020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000165293] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000178015]
Predicted Effect probably damaging
Transcript: ENSMUST00000020915
AA Change: I783N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: I783N

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111122
AA Change: I867N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: I867N

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111123
AA Change: I867N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: I867N

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163569
AA Change: I869N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: I869N

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000164818
AA Change: I172N
SMART Domains Protein: ENSMUSP00000129243
Gene: ENSMUSG00000020594
AA Change: I172N

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
Pumilio 75 110 2.35e-7 SMART
Pumilio 111 139 1.58e1 SMART
Pumilio 140 175 3.37e-8 SMART
Pumilio 176 211 4.84e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect probably damaging
Transcript: ENSMUST00000168361
AA Change: I869N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: I869N

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169089
AA Change: I788N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: I788N

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171608
Predicted Effect probably damaging
Transcript: ENSMUST00000178015
AA Change: I788N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: I788N

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Meta Mutation Damage Score 0.3446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Ralgapa1 T A 12: 55,693,458 N1328I probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8733381 missense probably damaging 1.00
IGL02118:Pum2 APN 12 8729117 missense probably benign 0.31
IGL02185:Pum2 APN 12 8748955 critical splice donor site probably null
IGL02528:Pum2 APN 12 8728696 nonsense probably null
IGL02718:Pum2 APN 12 8733344 missense probably benign 0.02
Plumbat UTSW 12 8728779 critical splice donor site probably null
Pummie UTSW 12 8713906 nonsense probably null
PIT4366001:Pum2 UTSW 12 8733390 missense probably damaging 1.00
R0152:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0317:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0357:Pum2 UTSW 12 8721785 missense possibly damaging 0.92
R0413:Pum2 UTSW 12 8713464 missense probably benign 0.00
R0494:Pum2 UTSW 12 8721736 nonsense probably null
R0520:Pum2 UTSW 12 8721710 missense probably damaging 1.00
R0727:Pum2 UTSW 12 8744465 missense probably damaging 1.00
R1576:Pum2 UTSW 12 8713524 missense probably benign 0.01
R2035:Pum2 UTSW 12 8728638 nonsense probably null
R2060:Pum2 UTSW 12 8728726 nonsense probably null
R2422:Pum2 UTSW 12 8748931 missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8744654 missense probably benign 0.19
R3767:Pum2 UTSW 12 8719076 nonsense probably null
R5155:Pum2 UTSW 12 8713572 missense possibly damaging 0.79
R5226:Pum2 UTSW 12 8713458 missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8744706 missense probably damaging 1.00
R6250:Pum2 UTSW 12 8744755 splice site probably null
R6253:Pum2 UTSW 12 8748205 missense probably damaging 1.00
R6508:Pum2 UTSW 12 8748861 missense probably benign 0.17
R6953:Pum2 UTSW 12 8728779 critical splice donor site probably null
R7135:Pum2 UTSW 12 8728952 missense possibly damaging 0.80
R7355:Pum2 UTSW 12 8713906 nonsense probably null
R7586:Pum2 UTSW 12 8747206 missense probably damaging 1.00
R7683:Pum2 UTSW 12 8728922 missense possibly damaging 0.93
R7869:Pum2 UTSW 12 8713595 missense probably benign 0.00
R7873:Pum2 UTSW 12 8748802 missense possibly damaging 0.94
R7980:Pum2 UTSW 12 8713904 missense probably damaging 0.98
R8166:Pum2 UTSW 12 8721739 missense possibly damaging 0.71
R8316:Pum2 UTSW 12 8713456 missense possibly damaging 0.89
R8345:Pum2 UTSW 12 8709454 missense probably damaging 0.99
R8418:Pum2 UTSW 12 8710245 missense possibly damaging 0.87
X0039:Pum2 UTSW 12 8728944 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTACTATCCAGTGATGTGCTTTAAC -3'
(R):5'- GAAGGGCCACATTTTAATGGAC -3'

Sequencing Primer
(F):5'- CTGAAGACAGCTACAGTGTGCTTAC -3'
(R):5'- TTCCCGGACCTAGCTGAGAATG -3'
Posted On2015-10-21