Incidental Mutation 'R4715:Ralgapa1'
ID353973
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 041982-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R4715 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55693458 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1328 (N1328I)
Ref Sequence ENSEMBL: ENSMUSP00000151498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably damaging
Transcript: ENSMUST00000085385
AA Change: N1328I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: N1328I

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110687
AA Change: N1328I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: N1328I

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219432
AA Change: N1375I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000219566
AA Change: N59I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220017
Predicted Effect probably damaging
Transcript: ENSMUST00000220367
AA Change: N1328I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226244
AA Change: N1784I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 E725A possibly damaging Het
Abcc5 G T 16: 20,398,876 L362I probably damaging Het
Ammecr1l C T 18: 31,774,653 R179* probably null Het
Arap2 G T 5: 62,749,094 T194K probably benign Het
Atf2 C A 2: 73,823,300 V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 S258G possibly damaging Het
Bptf G T 11: 107,047,181 H2695N probably damaging Het
Casq2 T C 3: 102,110,244 V80A probably benign Het
Ccdc130 A G 8: 84,263,874 I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 A11V probably benign Het
Cdh4 A T 2: 179,780,467 H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 *191L probably null Het
Cfdp1 G A 8: 111,830,891 T206I probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Clpx A C 9: 65,312,114 R231S possibly damaging Het
Copg1 T A 6: 87,912,286 L870* probably null Het
Cyp4a10 A T 4: 115,525,338 D275V probably benign Het
Dip2a T C 10: 76,296,406 T504A probably benign Het
Dmxl2 A C 9: 54,446,405 probably null Het
Dnaaf5 A T 5: 139,178,000 I671F probably damaging Het
Dnah14 A G 1: 181,757,223 D3173G probably damaging Het
Dock2 T C 11: 34,294,118 Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 M765L probably benign Het
E2f3 A C 13: 29,911,275 C220W probably damaging Het
Elf3 C T 1: 135,257,752 S8N probably damaging Het
F2rl1 A T 13: 95,513,267 V369E probably damaging Het
Fam214a T A 9: 75,012,968 W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 G267R probably benign Het
Ggact A T 14: 122,891,635 L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 noncoding transcript Het
Gm5546 T C 3: 104,366,508 noncoding transcript Het
Gm8267 A G 14: 44,717,835 V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 L146P probably damaging Het
Htr1b T C 9: 81,631,510 D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 L169P probably damaging Het
Klf17 T C 4: 117,760,536 D208G probably benign Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Map4k4 G A 1: 40,019,564 V1040I probably damaging Het
Mark1 A G 1: 184,912,132 V445A probably benign Het
Med11 T C 11: 70,453,196 I114T probably benign Het
Moxd2 A G 6: 40,887,247 V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 probably benign Het
Mrps27 A G 13: 99,414,815 probably null Het
Nop58 T C 1: 59,696,026 V75A probably benign Het
Olfr1290 A C 2: 111,489,744 M138R probably benign Het
Olfr1339 T C 4: 118,734,655 L42P probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 D195G probably damaging Het
Olfr832 A G 9: 18,945,446 H266R probably benign Het
Olfr844 C A 9: 19,319,147 F210L probably benign Het
Pdzd2 G T 15: 12,419,516 N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 probably benign Het
Prkd3 G T 17: 78,951,937 H864N possibly damaging Het
Ptprd T C 4: 76,107,333 T543A probably benign Het
Pum2 T A 12: 8,747,272 I788N probably damaging Het
Rhoc T C 3: 104,794,039 L193P probably damaging Het
Rif1 T C 2: 52,073,139 probably benign Het
Rspo2 A T 15: 43,075,904 C163* probably null Het
Sco1 A G 11: 67,056,599 Y204C probably damaging Het
Shc2 T C 10: 79,622,379 K490R probably benign Het
Siglec1 T C 2: 131,074,436 D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 V31A probably damaging Het
Smpd5 A T 15: 76,295,693 I112L probably benign Het
Synpr CT C 14: 13,285,198 probably null Het
Tdrd9 T G 12: 112,041,689 S988A probably benign Het
Tiam2 T A 17: 3,454,168 F982I probably damaging Het
Tmc3 G A 7: 83,622,396 V919I probably benign Het
Tmem200c A T 17: 68,840,470 D16V probably damaging Het
Tmem37 A T 1: 120,068,205 D47E probably damaging Het
Top3a T A 11: 60,742,997 R733* probably null Het
Treh T C 9: 44,683,318 V8A probably benign Het
Trim17 A C 11: 58,968,450 probably benign Het
Ubash3b T C 9: 41,016,600 K471E probably damaging Het
Usp8 T A 2: 126,729,222 L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 M1L unknown Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
wickedwarlock UTSW 12 55777292 missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 splice site probably null
R2203:Ralgapa1 UTSW 12 55612800 splice site probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55702457 missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55782846 missense probably damaging 0.99
R8213:Ralgapa1 UTSW 12 55722914 missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55741523 missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55659062 missense probably damaging 0.99
Z1176:Ralgapa1 UTSW 12 55709080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTGAAGGGACTAATTCCTAATA -3'
(R):5'- TTTGTTAAGCAAAGTGAGGAACAGAA -3'

Sequencing Primer
(F):5'- CTTAATCCTTGAGAGACGTGAGGCC -3'
(R):5'- ATAAAAACCGCACATACAAGCTTTGG -3'
Posted On2015-10-21