Incidental Mutation 'R4715:Abcc5'
ID 353985
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms 2900011L11Rik, Abcc5a, Mrp5, Abcc5b
MMRRC Submission 041982-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4715 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20331303-20426394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 20398876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 362 (L362I)
Ref Sequence ENSEMBL: ENSMUSP00000077031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077867] [ENSMUST00000079158] [ENSMUST00000096199] [ENSMUST00000115547] [ENSMUST00000232044]
AlphaFold Q9R1X5
Predicted Effect probably damaging
Transcript: ENSMUST00000077867
AA Change: L362I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077031
Gene: ENSMUSG00000022822
AA Change: L362I

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
Blast:AAA 463 512 2e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000079158
AA Change: L362I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: L362I

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096199
Predicted Effect probably damaging
Transcript: ENSMUST00000115547
AA Change: L362I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: L362I

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150340
Predicted Effect possibly damaging
Transcript: ENSMUST00000232044
AA Change: L25I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1249 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 92% (86/93)
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A C 19: 43,816,882 (GRCm38) E725A possibly damaging Het
Ammecr1l C T 18: 31,774,653 (GRCm38) R179* probably null Het
Arap2 G T 5: 62,749,094 (GRCm38) T194K probably benign Het
Atf2 C A 2: 73,823,300 (GRCm38) V282F probably damaging Het
Atp1a1 T C 3: 101,591,806 (GRCm38) E159G possibly damaging Het
B4galt2 T C 4: 117,877,179 (GRCm38) S258G possibly damaging Het
Bptf G T 11: 107,047,181 (GRCm38) H2695N probably damaging Het
Casq2 T C 3: 102,110,244 (GRCm38) V80A probably benign Het
Ccdc130 A G 8: 84,263,874 (GRCm38) I43T probably damaging Het
Cdc42ep3 G A 17: 79,335,458 (GRCm38) A11V probably benign Het
Cdh4 A T 2: 179,780,467 (GRCm38) H128L probably benign Het
Cdk5rap1 C A 2: 154,361,835 (GRCm38) *191L probably null Het
Cfdp1 G A 8: 111,830,891 (GRCm38) T206I probably benign Het
Cgn C A 3: 94,779,438 (GRCm38) G185W probably damaging Het
Clpx A C 9: 65,312,114 (GRCm38) R231S possibly damaging Het
Copg1 T A 6: 87,912,286 (GRCm38) L870* probably null Het
Cyp4a10 A T 4: 115,525,338 (GRCm38) D275V probably benign Het
Dip2a T C 10: 76,296,406 (GRCm38) T504A probably benign Het
Dmxl2 A C 9: 54,446,405 (GRCm38) probably null Het
Dnaaf5 A T 5: 139,178,000 (GRCm38) I671F probably damaging Het
Dnah14 A G 1: 181,757,223 (GRCm38) D3173G probably damaging Het
Dock2 T C 11: 34,294,118 (GRCm38) Y1074C probably damaging Het
Dthd1 A C 5: 62,888,187 (GRCm38) M765L probably benign Het
E2f3 A C 13: 29,911,275 (GRCm38) C220W probably damaging Het
Elf3 C T 1: 135,257,752 (GRCm38) S8N probably damaging Het
F2rl1 A T 13: 95,513,267 (GRCm38) V369E probably damaging Het
Fam214a T A 9: 75,012,968 (GRCm38) W799R probably damaging Het
Fpr-rs7 C T 17: 20,113,428 (GRCm38) G267R probably benign Het
Ggact A T 14: 122,891,635 (GRCm38) L56Q possibly damaging Het
Gm10698 A T 9: 33,728,488 (GRCm38) noncoding transcript Het
Gm5546 T C 3: 104,366,508 (GRCm38) noncoding transcript Het
Gm8267 A G 14: 44,717,835 (GRCm38) V243A probably benign Het
Gtf2h1 A G 7: 46,815,412 (GRCm38) T424A possibly damaging Het
Gucy1b2 A G 14: 62,423,017 (GRCm38) V140A possibly damaging Het
Htatip2 T C 7: 49,770,844 (GRCm38) L146P probably damaging Het
Htr1b T C 9: 81,631,510 (GRCm38) D348G possibly damaging Het
Ifi205 T C 1: 174,028,321 (GRCm38) I48V possibly damaging Het
Igkv18-36 C T 6: 69,992,591 (GRCm38) R72K probably damaging Het
Kcnk7 T C 19: 5,706,253 (GRCm38) L169P probably damaging Het
Klf17 T C 4: 117,760,536 (GRCm38) D208G probably benign Het
Ltn1 A G 16: 87,418,494 (GRCm38) F418L probably damaging Het
Map4k4 G A 1: 40,019,564 (GRCm38) V1040I probably damaging Het
Mark1 A G 1: 184,912,132 (GRCm38) V445A probably benign Het
Med11 T C 11: 70,453,196 (GRCm38) I114T probably benign Het
Moxd2 A G 6: 40,887,247 (GRCm38) V83A probably damaging Het
Mrpl33 A G 5: 31,616,358 (GRCm38) probably benign Het
Mrps27 A G 13: 99,414,815 (GRCm38) probably null Het
Nop58 T C 1: 59,696,026 (GRCm38) V75A probably benign Het
Olfr1290 A C 2: 111,489,744 (GRCm38) M138R probably benign Het
Olfr1339 T C 4: 118,734,655 (GRCm38) L42P probably damaging Het
Olfr136 A C 17: 38,335,840 (GRCm38) I228L possibly damaging Het
Olfr325 A G 11: 58,581,429 (GRCm38) D195G probably damaging Het
Olfr832 A G 9: 18,945,446 (GRCm38) H266R probably benign Het
Olfr844 C A 9: 19,319,147 (GRCm38) F210L probably benign Het
Pdzd2 G T 15: 12,419,516 (GRCm38) N263K possibly damaging Het
Podnl1 C A 8: 84,126,061 (GRCm38) probably benign Het
Prkd3 G T 17: 78,951,937 (GRCm38) H864N possibly damaging Het
Ptprd T C 4: 76,107,333 (GRCm38) T543A probably benign Het
Pum2 T A 12: 8,747,272 (GRCm38) I788N probably damaging Het
Ralgapa1 T A 12: 55,693,458 (GRCm38) N1328I probably damaging Het
Rhoc T C 3: 104,794,039 (GRCm38) L193P probably damaging Het
Rif1 T C 2: 52,073,139 (GRCm38) probably benign Het
Rspo2 A T 15: 43,075,904 (GRCm38) C163* probably null Het
Sco1 A G 11: 67,056,599 (GRCm38) Y204C probably damaging Het
Shc2 T C 10: 79,622,379 (GRCm38) K490R probably benign Het
Siglec1 T C 2: 131,074,436 (GRCm38) D1198G probably damaging Het
Slc25a18 T C 6: 120,786,090 (GRCm38) V31A probably damaging Het
Smpd5 A T 15: 76,295,693 (GRCm38) I112L probably benign Het
Synpr CT C 14: 13,285,198 (GRCm38) probably null Het
Tdrd9 T G 12: 112,041,689 (GRCm38) S988A probably benign Het
Tiam2 T A 17: 3,454,168 (GRCm38) F982I probably damaging Het
Tmc3 G A 7: 83,622,396 (GRCm38) V919I probably benign Het
Tmem200c A T 17: 68,840,470 (GRCm38) D16V probably damaging Het
Tmem37 A T 1: 120,068,205 (GRCm38) D47E probably damaging Het
Top3a T A 11: 60,742,997 (GRCm38) R733* probably null Het
Treh T C 9: 44,683,318 (GRCm38) V8A probably benign Het
Trim17 A C 11: 58,968,450 (GRCm38) probably benign Het
Ubash3b T C 9: 41,016,600 (GRCm38) K471E probably damaging Het
Usp8 T A 2: 126,729,222 (GRCm38) L144Q possibly damaging Het
Wnk2 T A 13: 49,147,232 (GRCm38) M1L unknown Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20,422,357 (GRCm38) missense probably benign 0.01
IGL00928:Abcc5 APN 16 20,398,970 (GRCm38) unclassified probably benign
IGL01350:Abcc5 APN 16 20,368,458 (GRCm38) missense probably benign 0.00
IGL01774:Abcc5 APN 16 20,378,457 (GRCm38) missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20,422,441 (GRCm38) utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20,422,437 (GRCm38) utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20,338,925 (GRCm38) missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20,368,464 (GRCm38) missense probably benign 0.06
IGL02938:Abcc5 APN 16 20,362,229 (GRCm38) missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20,392,811 (GRCm38) utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20,399,560 (GRCm38) missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20,357,378 (GRCm38) missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20,378,661 (GRCm38) nonsense probably null
R0021:Abcc5 UTSW 16 20,378,661 (GRCm38) nonsense probably null
R0220:Abcc5 UTSW 16 20,369,102 (GRCm38) missense probably benign
R0281:Abcc5 UTSW 16 20,422,400 (GRCm38) missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20,376,558 (GRCm38) missense probably benign 0.09
R0448:Abcc5 UTSW 16 20,399,937 (GRCm38) missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20,398,885 (GRCm38) missense probably damaging 0.96
R0477:Abcc5 UTSW 16 20,368,569 (GRCm38) missense possibly damaging 0.51
R0601:Abcc5 UTSW 16 20,404,559 (GRCm38) splice site probably benign
R0648:Abcc5 UTSW 16 20,365,882 (GRCm38) missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20,376,592 (GRCm38) missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20,422,438 (GRCm38) utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20,398,867 (GRCm38) missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20,365,817 (GRCm38) missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20,333,588 (GRCm38) missense probably benign 0.01
R1789:Abcc5 UTSW 16 20,365,951 (GRCm38) missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20,338,887 (GRCm38) missense probably benign 0.43
R1909:Abcc5 UTSW 16 20,376,509 (GRCm38) critical splice donor site probably null
R2046:Abcc5 UTSW 16 20,399,817 (GRCm38) missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20,405,882 (GRCm38) missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20,375,113 (GRCm38) missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20,405,552 (GRCm38) splice site probably benign
R3708:Abcc5 UTSW 16 20,372,180 (GRCm38) missense probably benign 0.30
R3731:Abcc5 UTSW 16 20,398,934 (GRCm38) nonsense probably null
R3829:Abcc5 UTSW 16 20,365,865 (GRCm38) missense probably benign 0.00
R3847:Abcc5 UTSW 16 20,372,156 (GRCm38) missense probably benign 0.12
R3850:Abcc5 UTSW 16 20,372,156 (GRCm38) missense probably benign 0.12
R3955:Abcc5 UTSW 16 20,405,543 (GRCm38) missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20,333,695 (GRCm38) missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20,368,187 (GRCm38) splice site probably null
R4433:Abcc5 UTSW 16 20,368,187 (GRCm38) splice site probably null
R4505:Abcc5 UTSW 16 20,333,695 (GRCm38) missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20,333,695 (GRCm38) missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20,399,626 (GRCm38) missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20,422,432 (GRCm38) start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20,399,928 (GRCm38) missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20,376,546 (GRCm38) missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20,376,662 (GRCm38) missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20,338,922 (GRCm38) missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20,338,886 (GRCm38) missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20,399,847 (GRCm38) missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20,399,894 (GRCm38) missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20,392,779 (GRCm38) missense probably benign 0.02
R6213:Abcc5 UTSW 16 20,400,012 (GRCm38) missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20,376,594 (GRCm38) missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20,404,684 (GRCm38) missense probably benign 0.01
R6815:Abcc5 UTSW 16 20,333,630 (GRCm38) missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20,378,744 (GRCm38) missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20,400,009 (GRCm38) missense probably benign
R7167:Abcc5 UTSW 16 20,405,501 (GRCm38) missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20,376,508 (GRCm38) splice site probably null
R7318:Abcc5 UTSW 16 20,392,543 (GRCm38) missense probably benign 0.01
R7380:Abcc5 UTSW 16 20,397,034 (GRCm38) missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20,422,423 (GRCm38) missense possibly damaging 0.57
R7451:Abcc5 UTSW 16 20,375,070 (GRCm38) missense probably damaging 1.00
R7475:Abcc5 UTSW 16 20,399,989 (GRCm38) missense probably benign 0.04
R7567:Abcc5 UTSW 16 20,405,510 (GRCm38) missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20,375,132 (GRCm38) nonsense probably null
R7623:Abcc5 UTSW 16 20,344,696 (GRCm38) missense possibly damaging 0.95
R7682:Abcc5 UTSW 16 20,368,053 (GRCm38) missense probably damaging 1.00
R8128:Abcc5 UTSW 16 20,365,723 (GRCm38) missense probably damaging 0.98
R8327:Abcc5 UTSW 16 20,422,318 (GRCm38) missense probably benign 0.00
R8518:Abcc5 UTSW 16 20,404,648 (GRCm38) missense possibly damaging 0.80
R8678:Abcc5 UTSW 16 20,365,935 (GRCm38) missense probably benign 0.31
R8679:Abcc5 UTSW 16 20,333,729 (GRCm38) missense possibly damaging 0.89
R9206:Abcc5 UTSW 16 20,389,389 (GRCm38) missense probably benign 0.00
R9254:Abcc5 UTSW 16 20,333,687 (GRCm38) missense probably damaging 1.00
R9379:Abcc5 UTSW 16 20,333,687 (GRCm38) missense probably damaging 1.00
R9501:Abcc5 UTSW 16 20,396,103 (GRCm38) missense probably damaging 1.00
R9647:Abcc5 UTSW 16 20,376,560 (GRCm38) missense probably benign 0.01
X0022:Abcc5 UTSW 16 20,392,587 (GRCm38) missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20,364,042 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGAAGTCTAGTTTCTAATGTGCTTAG -3'
(R):5'- TGTTTGTCCCAGGAACAGG -3'

Sequencing Primer
(F):5'- CATCAGAAGTCTAGTTTCTAATGTGC -3'
(R):5'- TTTGTCCCAGGAACAGGCTCTG -3'
Posted On 2015-10-21