Incidental Mutation 'R4716:Slc29a4'
ID354025
Institutional Source Beutler Lab
Gene Symbol Slc29a4
Ensembl Gene ENSMUSG00000050822
Gene Namesolute carrier family 29 (nucleoside transporters), member 4
SynonymsmPMAT, ENT4
MMRRC Submission 041983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4716 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location142692512-142722490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142718572 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 327 (V327A)
Ref Sequence ENSEMBL: ENSMUSP00000059896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058418]
Predicted Effect probably benign
Transcript: ENSMUST00000058418
AA Change: V327A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059896
Gene: ENSMUSG00000050822
AA Change: V327A

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Nucleoside_tran 170 501 2e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC29A/ENT transporter protein family. The encoded membrane protein catalyzes the reuptake of monoamines into presynaptic neurons, thus determining the intensity and duration of monoamine neural signaling. It has been shown to transport several compounds, including serotonin, dopamine, and the neurotoxin 1-methyl-4-phenylpyridinium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic cation and monoamine uptake in the choroid plexus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,342 S233P probably damaging Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adam8 T A 7: 139,983,938 D717V probably benign Het
Aknad1 T C 3: 108,775,101 probably null Het
Alk A T 17: 72,205,942 W341R probably damaging Het
Ankdd1b G A 13: 96,454,583 Q101* probably null Het
Anpep A C 7: 79,826,632 S829A probably benign Het
Ate1 A T 7: 130,513,781 C72S probably damaging Het
Atp6v0a4 G A 6: 38,061,064 L533F probably damaging Het
Bach1 T C 16: 87,715,379 probably benign Het
Baz2b T C 2: 59,969,255 D240G probably benign Het
Cdc14b C T 13: 64,209,200 S21N probably damaging Het
Cdh3 A G 8: 106,543,888 I466V probably benign Het
Cog1 A G 11: 113,657,097 E137G probably damaging Het
Col4a2 A G 8: 11,402,224 D180G probably damaging Het
Cyp2c40 A T 19: 39,802,661 probably null Het
Dclk2 C T 3: 86,919,881 R97H probably damaging Het
Ddx52 T C 11: 83,955,205 probably null Het
Dhx58 C T 11: 100,696,971 probably null Het
Dmp1 T A 5: 104,212,561 S368T probably damaging Het
Dnah17 C A 11: 118,073,648 V2435L probably benign Het
Dnajc7 A G 11: 100,619,576 V10A probably benign Het
Dscam G T 16: 96,619,571 T1705K possibly damaging Het
Dscaml1 G A 9: 45,450,592 V217M probably damaging Het
Dync2h1 A G 9: 7,142,648 probably null Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam174a C T 1: 95,314,045 P77S probably benign Het
Fars2 G A 13: 36,205,068 R180H probably damaging Het
Fnbp1 T C 2: 31,055,520 T154A probably benign Het
Fsip2 T A 2: 82,974,859 N507K probably damaging Het
Glg1 G T 8: 111,160,775 Y449* probably null Het
Gm15130 A T 2: 111,134,215 Y187* probably null Het
Gm973 A T 1: 59,552,554 K366* probably null Het
Hao1 A G 2: 134,505,620 I255T probably damaging Het
Herc6 T A 6: 57,598,438 V148E probably damaging Het
Hist1h2bj T A 13: 22,043,363 V45E possibly damaging Het
Insm2 T A 12: 55,600,892 C474S possibly damaging Het
Itch T C 2: 155,210,582 probably null Het
Itga2 A G 13: 114,857,373 V748A probably damaging Het
Itga9 T A 9: 118,681,758 S452T probably damaging Het
Kdm4b C A 17: 56,386,178 D338E probably benign Het
Krt40 G A 11: 99,540,219 R155C probably damaging Het
Krtap16-1 A G 11: 99,985,174 V468A probably damaging Het
Lactb2 G A 1: 13,638,395 P143L probably damaging Het
Lrba C A 3: 86,642,714 T2330K probably damaging Het
Lrp2bp A T 8: 46,013,171 I106F probably benign Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Lypd6 T C 2: 50,188,843 probably null Het
Maml1 A T 11: 50,257,867 D1015E probably benign Het
Mdfi T G 17: 47,820,981 D106A possibly damaging Het
Olfm3 T C 3: 115,081,106 M17T probably benign Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr1394 A G 11: 49,160,890 Y292C probably damaging Het
Olfr894 T A 9: 38,219,418 N198K probably damaging Het
Olfr948 A G 9: 39,319,429 F62L probably benign Het
Otud7b T G 3: 96,150,910 L261V probably damaging Het
P2ry1 A G 3: 61,003,472 N11D probably damaging Het
Pate2 T C 9: 35,685,682 probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Per1 A G 11: 69,101,231 E137G probably damaging Het
Phf11d T C 14: 59,353,342 T189A probably benign Het
Pik3r5 C A 11: 68,495,204 S738R possibly damaging Het
Pikfyve A G 1: 65,246,476 Y913C possibly damaging Het
Pkd1 T G 17: 24,576,133 S2265A probably damaging Het
Pkhd1l1 C A 15: 44,556,032 N2964K probably damaging Het
Plch1 T G 3: 63,781,546 D79A probably damaging Het
Pnliprp1 A C 19: 58,740,469 T363P possibly damaging Het
Ppp1r10 T A 17: 35,929,460 D547E probably benign Het
Prkdc T A 16: 15,810,837 I3482K probably benign Het
Ptpn4 A G 1: 119,721,868 Y333H probably damaging Het
Ptpru T A 4: 131,820,968 M73L probably benign Het
Rrp12 A G 19: 41,877,428 Y698H probably damaging Het
Scaf8 T C 17: 3,177,123 F338L unknown Het
Slc17a1 G T 13: 23,880,593 V347L probably benign Het
Slc1a2 T A 2: 102,748,538 V263E probably damaging Het
Slc6a3 A C 13: 73,557,076 I229L probably benign Het
Sos2 T C 12: 69,607,371 I703V probably benign Het
Srpk1 T C 17: 28,622,008 T15A probably benign Het
St6gal2 A T 17: 55,510,366 Q510L probably benign Het
Stk24 T C 14: 121,294,718 D289G possibly damaging Het
Taf2 T G 15: 55,065,968 K64T probably benign Het
Tbx3 A G 5: 119,675,670 E257G possibly damaging Het
Tmem102 A T 11: 69,804,196 F317I probably damaging Het
Trav10 A G 14: 53,506,040 S33G possibly damaging Het
Ttn T A 2: 76,915,064 I5214F probably damaging Het
Ube2f T A 1: 91,254,280 L2Q probably damaging Het
Ube4b A G 4: 149,344,612 F857L probably damaging Het
Vmn2r18 T A 5: 151,562,137 I631F possibly damaging Het
Zfp280d T A 9: 72,312,665 S241T possibly damaging Het
Zfp638 T A 6: 83,979,562 L1717* probably null Het
Zfp719 A G 7: 43,591,111 N708D possibly damaging Het
Other mutations in Slc29a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Slc29a4 APN 5 142705530 missense probably benign 0.02
IGL01717:Slc29a4 APN 5 142718746 missense probably damaging 1.00
IGL02184:Slc29a4 APN 5 142717751 missense probably damaging 1.00
IGL02207:Slc29a4 APN 5 142718885 missense possibly damaging 0.76
IGL02210:Slc29a4 APN 5 142718779 missense probably damaging 1.00
IGL02323:Slc29a4 APN 5 142717652 missense probably damaging 0.99
IGL02381:Slc29a4 APN 5 142720099 missense probably benign 0.34
IGL03103:Slc29a4 APN 5 142712080 missense probably damaging 1.00
IGL03210:Slc29a4 APN 5 142715108 missense probably damaging 1.00
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0132:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0850:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R1777:Slc29a4 UTSW 5 142714062 missense probably damaging 0.96
R1864:Slc29a4 UTSW 5 142717754 missense probably damaging 1.00
R1870:Slc29a4 UTSW 5 142721488 makesense probably null
R1871:Slc29a4 UTSW 5 142721488 makesense probably null
R2092:Slc29a4 UTSW 5 142718855 missense probably damaging 1.00
R2196:Slc29a4 UTSW 5 142712895 missense possibly damaging 0.94
R5002:Slc29a4 UTSW 5 142718746 missense probably damaging 1.00
R5162:Slc29a4 UTSW 5 142721452 missense possibly damaging 0.80
R5235:Slc29a4 UTSW 5 142718768 missense probably damaging 1.00
R5553:Slc29a4 UTSW 5 142720036 missense probably damaging 1.00
R5642:Slc29a4 UTSW 5 142711972 missense probably damaging 1.00
R5688:Slc29a4 UTSW 5 142714098 missense possibly damaging 0.68
R5930:Slc29a4 UTSW 5 142721402 missense possibly damaging 0.90
R5944:Slc29a4 UTSW 5 142718818 missense probably damaging 1.00
R6056:Slc29a4 UTSW 5 142720077 missense probably damaging 0.99
R6409:Slc29a4 UTSW 5 142712071 missense probably damaging 1.00
R6934:Slc29a4 UTSW 5 142712958 missense probably benign 0.02
R7508:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7509:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7716:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7910:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
R7991:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGATGACTGTGGCTCCAC -3'
(R):5'- TGAAGTAGGTTACCGCAATGGAC -3'

Sequencing Primer
(F):5'- ACCATTTGCTCTGGGTATCTAAC -3'
(R):5'- GTTACCGCAATGGACAGCATGTC -3'
Posted On2015-10-21