Incidental Mutation 'R4716:Atp6v0a4'
ID 354028
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms V-ATPase alpha 4, Atp6n1b
MMRRC Submission 041983-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4716 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 38048483-38124586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38061064 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 533 (L533F)
Ref Sequence ENSEMBL: ENSMUSP00000110558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]
AlphaFold Q920R6
Predicted Effect probably damaging
Transcript: ENSMUST00000040259
AA Change: L533F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: L533F

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114908
AA Change: L533F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: L533F

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,342 S233P probably damaging Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adam8 T A 7: 139,983,938 D717V probably benign Het
Aknad1 T C 3: 108,775,101 probably null Het
Alk A T 17: 72,205,942 W341R probably damaging Het
Ankdd1b G A 13: 96,454,583 Q101* probably null Het
Anpep A C 7: 79,826,632 S829A probably benign Het
Ate1 A T 7: 130,513,781 C72S probably damaging Het
Bach1 T C 16: 87,715,379 probably benign Het
Baz2b T C 2: 59,969,255 D240G probably benign Het
Cdc14b C T 13: 64,209,200 S21N probably damaging Het
Cdh3 A G 8: 106,543,888 I466V probably benign Het
Cog1 A G 11: 113,657,097 E137G probably damaging Het
Col4a2 A G 8: 11,402,224 D180G probably damaging Het
Cyp2c40 A T 19: 39,802,661 probably null Het
Dclk2 C T 3: 86,919,881 R97H probably damaging Het
Ddx52 T C 11: 83,955,205 probably null Het
Dhx58 C T 11: 100,696,971 probably null Het
Dmp1 T A 5: 104,212,561 S368T probably damaging Het
Dnah17 C A 11: 118,073,648 V2435L probably benign Het
Dnajc7 A G 11: 100,619,576 V10A probably benign Het
Dscam G T 16: 96,619,571 T1705K possibly damaging Het
Dscaml1 G A 9: 45,450,592 V217M probably damaging Het
Dync2h1 A G 9: 7,142,648 probably null Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam174a C T 1: 95,314,045 P77S probably benign Het
Fars2 G A 13: 36,205,068 R180H probably damaging Het
Fnbp1 T C 2: 31,055,520 T154A probably benign Het
Fsip2 T A 2: 82,974,859 N507K probably damaging Het
Glg1 G T 8: 111,160,775 Y449* probably null Het
Gm15130 A T 2: 111,134,215 Y187* probably null Het
Gm973 A T 1: 59,552,554 K366* probably null Het
Hao1 A G 2: 134,505,620 I255T probably damaging Het
Herc6 T A 6: 57,598,438 V148E probably damaging Het
Hist1h2bj T A 13: 22,043,363 V45E possibly damaging Het
Insm2 T A 12: 55,600,892 C474S possibly damaging Het
Itch T C 2: 155,210,582 probably null Het
Itga2 A G 13: 114,857,373 V748A probably damaging Het
Itga9 T A 9: 118,681,758 S452T probably damaging Het
Kdm4b C A 17: 56,386,178 D338E probably benign Het
Krt40 G A 11: 99,540,219 R155C probably damaging Het
Krtap16-1 A G 11: 99,985,174 V468A probably damaging Het
Lactb2 G A 1: 13,638,395 P143L probably damaging Het
Lrba C A 3: 86,642,714 T2330K probably damaging Het
Lrp2bp A T 8: 46,013,171 I106F probably benign Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Lypd6 T C 2: 50,188,843 probably null Het
Maml1 A T 11: 50,257,867 D1015E probably benign Het
Mdfi T G 17: 47,820,981 D106A possibly damaging Het
Olfm3 T C 3: 115,081,106 M17T probably benign Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr1394 A G 11: 49,160,890 Y292C probably damaging Het
Olfr894 T A 9: 38,219,418 N198K probably damaging Het
Olfr948 A G 9: 39,319,429 F62L probably benign Het
Otud7b T G 3: 96,150,910 L261V probably damaging Het
P2ry1 A G 3: 61,003,472 N11D probably damaging Het
Pate2 T C 9: 35,685,682 probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Per1 A G 11: 69,101,231 E137G probably damaging Het
Phf11d T C 14: 59,353,342 T189A probably benign Het
Pik3r5 C A 11: 68,495,204 S738R possibly damaging Het
Pikfyve A G 1: 65,246,476 Y913C possibly damaging Het
Pkd1 T G 17: 24,576,133 S2265A probably damaging Het
Pkhd1l1 C A 15: 44,556,032 N2964K probably damaging Het
Plch1 T G 3: 63,781,546 D79A probably damaging Het
Pnliprp1 A C 19: 58,740,469 T363P possibly damaging Het
Ppp1r10 T A 17: 35,929,460 D547E probably benign Het
Prkdc T A 16: 15,810,837 I3482K probably benign Het
Ptpn4 A G 1: 119,721,868 Y333H probably damaging Het
Ptpru T A 4: 131,820,968 M73L probably benign Het
Rrp12 A G 19: 41,877,428 Y698H probably damaging Het
Scaf8 T C 17: 3,177,123 F338L unknown Het
Slc17a1 G T 13: 23,880,593 V347L probably benign Het
Slc1a2 T A 2: 102,748,538 V263E probably damaging Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Slc6a3 A C 13: 73,557,076 I229L probably benign Het
Sos2 T C 12: 69,607,371 I703V probably benign Het
Srpk1 T C 17: 28,622,008 T15A probably benign Het
St6gal2 A T 17: 55,510,366 Q510L probably benign Het
Stk24 T C 14: 121,294,718 D289G possibly damaging Het
Taf2 T G 15: 55,065,968 K64T probably benign Het
Tbx3 A G 5: 119,675,670 E257G possibly damaging Het
Tmem102 A T 11: 69,804,196 F317I probably damaging Het
Trav10 A G 14: 53,506,040 S33G possibly damaging Het
Ttn T A 2: 76,915,064 I5214F probably damaging Het
Ube2f T A 1: 91,254,280 L2Q probably damaging Het
Ube4b A G 4: 149,344,612 F857L probably damaging Het
Vmn2r18 T A 5: 151,562,137 I631F possibly damaging Het
Zfp280d T A 9: 72,312,665 S241T possibly damaging Het
Zfp638 T A 6: 83,979,562 L1717* probably null Het
Zfp719 A G 7: 43,591,111 N708D possibly damaging Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
R8683:Atp6v0a4 UTSW 6 38048991 makesense probably null
R9007:Atp6v0a4 UTSW 6 38053053 missense probably benign
R9359:Atp6v0a4 UTSW 6 38082113 missense probably benign 0.21
R9475:Atp6v0a4 UTSW 6 38060982 missense probably damaging 1.00
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGCCATCAGGTGAGCAAG -3'
(R):5'- GACAACAGGCTCGTCCTTTC -3'

Sequencing Primer
(F):5'- GTAGAAGATGGCTCATCAGTCCTC -3'
(R):5'- CCCTTCTCTGAGCCCGATG -3'
Posted On 2015-10-21