Incidental Mutation 'R4716:Dscaml1'
ID354045
Institutional Source Beutler Lab
Gene Symbol Dscaml1
Ensembl Gene ENSMUSG00000032087
Gene NameDS cell adhesion molecule like 1
Synonyms4921507G06Rik, 4930435C18Rik
MMRRC Submission 041983-MU
Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R4716 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45426628-45753712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45450592 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 217 (V217M)
Ref Sequence ENSEMBL: ENSMUSP00000034592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034592] [ENSMUST00000213919] [ENSMUST00000217538]
Predicted Effect probably damaging
Transcript: ENSMUST00000034592
AA Change: V217M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: V217M

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
IG_like 96 168 1.22e0 SMART
IG 189 277 1.15e-3 SMART
IGc2 296 359 2.54e-14 SMART
IGc2 385 451 8.12e-13 SMART
IGc2 478 550 9.55e-10 SMART
IGc2 575 640 9.78e-7 SMART
IGc2 666 734 5.93e-6 SMART
IGc2 760 832 6.75e-10 SMART
IG 853 943 1e-3 SMART
FN3 945 1029 6.64e-7 SMART
FN3 1045 1133 9.46e-12 SMART
FN3 1148 1234 3.2e-9 SMART
FN3 1249 1332 3.48e-10 SMART
IGc2 1363 1428 1.49e-11 SMART
FN3 1442 1522 3.42e-9 SMART
FN3 1537 1618 2.14e-1 SMART
low complexity region 1671 1683 N/A INTRINSIC
low complexity region 2018 2026 N/A INTRINSIC
low complexity region 2035 2069 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000213919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217335
Predicted Effect silent
Transcript: ENSMUST00000217538
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,342 S233P probably damaging Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adam8 T A 7: 139,983,938 D717V probably benign Het
Aknad1 T C 3: 108,775,101 probably null Het
Alk A T 17: 72,205,942 W341R probably damaging Het
Ankdd1b G A 13: 96,454,583 Q101* probably null Het
Anpep A C 7: 79,826,632 S829A probably benign Het
Ate1 A T 7: 130,513,781 C72S probably damaging Het
Atp6v0a4 G A 6: 38,061,064 L533F probably damaging Het
Bach1 T C 16: 87,715,379 probably benign Het
Baz2b T C 2: 59,969,255 D240G probably benign Het
Cdc14b C T 13: 64,209,200 S21N probably damaging Het
Cdh3 A G 8: 106,543,888 I466V probably benign Het
Cog1 A G 11: 113,657,097 E137G probably damaging Het
Col4a2 A G 8: 11,402,224 D180G probably damaging Het
Cyp2c40 A T 19: 39,802,661 probably null Het
Dclk2 C T 3: 86,919,881 R97H probably damaging Het
Ddx52 T C 11: 83,955,205 probably null Het
Dhx58 C T 11: 100,696,971 probably null Het
Dmp1 T A 5: 104,212,561 S368T probably damaging Het
Dnah17 C A 11: 118,073,648 V2435L probably benign Het
Dnajc7 A G 11: 100,619,576 V10A probably benign Het
Dscam G T 16: 96,619,571 T1705K possibly damaging Het
Dync2h1 A G 9: 7,142,648 probably null Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam174a C T 1: 95,314,045 P77S probably benign Het
Fars2 G A 13: 36,205,068 R180H probably damaging Het
Fnbp1 T C 2: 31,055,520 T154A probably benign Het
Fsip2 T A 2: 82,974,859 N507K probably damaging Het
Glg1 G T 8: 111,160,775 Y449* probably null Het
Gm15130 A T 2: 111,134,215 Y187* probably null Het
Gm973 A T 1: 59,552,554 K366* probably null Het
Hao1 A G 2: 134,505,620 I255T probably damaging Het
Herc6 T A 6: 57,598,438 V148E probably damaging Het
Hist1h2bj T A 13: 22,043,363 V45E possibly damaging Het
Insm2 T A 12: 55,600,892 C474S possibly damaging Het
Itch T C 2: 155,210,582 probably null Het
Itga2 A G 13: 114,857,373 V748A probably damaging Het
Itga9 T A 9: 118,681,758 S452T probably damaging Het
Kdm4b C A 17: 56,386,178 D338E probably benign Het
Krt40 G A 11: 99,540,219 R155C probably damaging Het
Krtap16-1 A G 11: 99,985,174 V468A probably damaging Het
Lactb2 G A 1: 13,638,395 P143L probably damaging Het
Lrba C A 3: 86,642,714 T2330K probably damaging Het
Lrp2bp A T 8: 46,013,171 I106F probably benign Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Lypd6 T C 2: 50,188,843 probably null Het
Maml1 A T 11: 50,257,867 D1015E probably benign Het
Mdfi T G 17: 47,820,981 D106A possibly damaging Het
Olfm3 T C 3: 115,081,106 M17T probably benign Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr1394 A G 11: 49,160,890 Y292C probably damaging Het
Olfr894 T A 9: 38,219,418 N198K probably damaging Het
Olfr948 A G 9: 39,319,429 F62L probably benign Het
Otud7b T G 3: 96,150,910 L261V probably damaging Het
P2ry1 A G 3: 61,003,472 N11D probably damaging Het
Pate2 T C 9: 35,685,682 probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Per1 A G 11: 69,101,231 E137G probably damaging Het
Phf11d T C 14: 59,353,342 T189A probably benign Het
Pik3r5 C A 11: 68,495,204 S738R possibly damaging Het
Pikfyve A G 1: 65,246,476 Y913C possibly damaging Het
Pkd1 T G 17: 24,576,133 S2265A probably damaging Het
Pkhd1l1 C A 15: 44,556,032 N2964K probably damaging Het
Plch1 T G 3: 63,781,546 D79A probably damaging Het
Pnliprp1 A C 19: 58,740,469 T363P possibly damaging Het
Ppp1r10 T A 17: 35,929,460 D547E probably benign Het
Prkdc T A 16: 15,810,837 I3482K probably benign Het
Ptpn4 A G 1: 119,721,868 Y333H probably damaging Het
Ptpru T A 4: 131,820,968 M73L probably benign Het
Rrp12 A G 19: 41,877,428 Y698H probably damaging Het
Scaf8 T C 17: 3,177,123 F338L unknown Het
Slc17a1 G T 13: 23,880,593 V347L probably benign Het
Slc1a2 T A 2: 102,748,538 V263E probably damaging Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Slc6a3 A C 13: 73,557,076 I229L probably benign Het
Sos2 T C 12: 69,607,371 I703V probably benign Het
Srpk1 T C 17: 28,622,008 T15A probably benign Het
St6gal2 A T 17: 55,510,366 Q510L probably benign Het
Stk24 T C 14: 121,294,718 D289G possibly damaging Het
Taf2 T G 15: 55,065,968 K64T probably benign Het
Tbx3 A G 5: 119,675,670 E257G possibly damaging Het
Tmem102 A T 11: 69,804,196 F317I probably damaging Het
Trav10 A G 14: 53,506,040 S33G possibly damaging Het
Ttn T A 2: 76,915,064 I5214F probably damaging Het
Ube2f T A 1: 91,254,280 L2Q probably damaging Het
Ube4b A G 4: 149,344,612 F857L probably damaging Het
Vmn2r18 T A 5: 151,562,137 I631F possibly damaging Het
Zfp280d T A 9: 72,312,665 S241T possibly damaging Het
Zfp638 T A 6: 83,979,562 L1717* probably null Het
Zfp719 A G 7: 43,591,111 N708D possibly damaging Het
Other mutations in Dscaml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dscaml1 APN 9 45670200 nonsense probably null
IGL00497:Dscaml1 APN 9 45752238 missense probably damaging 1.00
IGL00895:Dscaml1 APN 9 45751253 missense probably damaging 0.99
IGL01011:Dscaml1 APN 9 45683672 missense possibly damaging 0.76
IGL01086:Dscaml1 APN 9 45702662 splice site probably benign
IGL01125:Dscaml1 APN 9 45749632 critical splice acceptor site probably null
IGL01132:Dscaml1 APN 9 45752328 nonsense probably null
IGL01356:Dscaml1 APN 9 45746857 missense probably benign 0.03
IGL01459:Dscaml1 APN 9 45742683 nonsense probably null
IGL01552:Dscaml1 APN 9 45447908 missense probably damaging 1.00
IGL02033:Dscaml1 APN 9 45683782 missense probably damaging 1.00
IGL02044:Dscaml1 APN 9 45746943 nonsense probably null
IGL02095:Dscaml1 APN 9 45447703 missense probably damaging 1.00
IGL02166:Dscaml1 APN 9 45683701 missense probably damaging 0.98
IGL02262:Dscaml1 APN 9 45745116 missense probably benign
IGL02262:Dscaml1 APN 9 45732080 missense probably benign 0.44
IGL02340:Dscaml1 APN 9 45670176 missense possibly damaging 0.66
IGL02604:Dscaml1 APN 9 45744328 unclassified probably benign
IGL02619:Dscaml1 APN 9 45447796 missense probably damaging 1.00
IGL02805:Dscaml1 APN 9 45447897 missense probably damaging 0.98
IGL03409:Dscaml1 APN 9 45670103 missense probably damaging 1.00
D3080:Dscaml1 UTSW 9 45684325 missense probably benign 0.44
IGL03050:Dscaml1 UTSW 9 45742999 missense probably damaging 1.00
R0149:Dscaml1 UTSW 9 45742680 nonsense probably null
R0582:Dscaml1 UTSW 9 45668264 missense possibly damaging 0.77
R0629:Dscaml1 UTSW 9 45721418 missense probably damaging 0.98
R0632:Dscaml1 UTSW 9 45732134 missense probably benign 0.06
R0815:Dscaml1 UTSW 9 45745074 missense probably benign 0.00
R1162:Dscaml1 UTSW 9 45752349 splice site probably benign
R1449:Dscaml1 UTSW 9 45742223 missense possibly damaging 0.95
R1474:Dscaml1 UTSW 9 45685221 missense probably damaging 1.00
R1481:Dscaml1 UTSW 9 45672643 missense probably benign 0.01
R1533:Dscaml1 UTSW 9 45450584 missense probably damaging 0.99
R1542:Dscaml1 UTSW 9 45749440 missense possibly damaging 0.84
R1572:Dscaml1 UTSW 9 45721333 missense probably benign 0.00
R1627:Dscaml1 UTSW 9 45753147 missense probably damaging 1.00
R1634:Dscaml1 UTSW 9 45672749 missense probably damaging 1.00
R1713:Dscaml1 UTSW 9 45752690 missense possibly damaging 0.49
R1777:Dscaml1 UTSW 9 45683756 missense possibly damaging 0.58
R1812:Dscaml1 UTSW 9 45751286 critical splice donor site probably null
R1834:Dscaml1 UTSW 9 45683632 missense probably benign 0.00
R1907:Dscaml1 UTSW 9 45740480 missense probably damaging 1.00
R1953:Dscaml1 UTSW 9 45670224 missense probably benign 0.01
R2056:Dscaml1 UTSW 9 45750132 missense probably damaging 0.99
R2193:Dscaml1 UTSW 9 45685234 missense probably benign 0.21
R2497:Dscaml1 UTSW 9 45745078 missense probably benign 0.00
R3768:Dscaml1 UTSW 9 45732137 missense possibly damaging 0.94
R3891:Dscaml1 UTSW 9 45717484 missense possibly damaging 0.84
R4110:Dscaml1 UTSW 9 45732068 missense probably benign 0.07
R4706:Dscaml1 UTSW 9 45450580 missense probably damaging 1.00
R4719:Dscaml1 UTSW 9 45672695 missense probably benign 0.13
R4770:Dscaml1 UTSW 9 45670106 missense probably damaging 1.00
R4924:Dscaml1 UTSW 9 45745189 missense probably damaging 1.00
R5167:Dscaml1 UTSW 9 45717432 missense probably damaging 1.00
R5346:Dscaml1 UTSW 9 45450559 missense possibly damaging 0.63
R5737:Dscaml1 UTSW 9 45745185 missense probably damaging 0.99
R5977:Dscaml1 UTSW 9 45721298 missense probably benign 0.19
R6073:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6276:Dscaml1 UTSW 9 45668160 missense possibly damaging 0.62
R6415:Dscaml1 UTSW 9 45683677 nonsense probably null
R6527:Dscaml1 UTSW 9 45712184 nonsense probably null
R6582:Dscaml1 UTSW 9 45752806 missense probably benign 0.00
R6655:Dscaml1 UTSW 9 45746937 missense probably benign 0.00
R6772:Dscaml1 UTSW 9 45710311 missense probably damaging 1.00
R6799:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6892:Dscaml1 UTSW 9 45683830 missense probably damaging 0.99
R6918:Dscaml1 UTSW 9 45430507 missense probably benign
R6967:Dscaml1 UTSW 9 45674523 missense probably damaging 0.97
R7214:Dscaml1 UTSW 9 45670139 missense probably benign 0.01
R7286:Dscaml1 UTSW 9 45742746 critical splice donor site probably null
R7315:Dscaml1 UTSW 9 45745125 missense probably benign 0.00
R7338:Dscaml1 UTSW 9 45674504 missense probably benign 0.12
R7343:Dscaml1 UTSW 9 45752916 missense probably benign
R7395:Dscaml1 UTSW 9 45702405 missense possibly damaging 0.73
R7439:Dscaml1 UTSW 9 45710326 missense possibly damaging 0.94
R7484:Dscaml1 UTSW 9 45749446 splice site probably null
R7545:Dscaml1 UTSW 9 45685383 missense probably benign 0.11
R8005:Dscaml1 UTSW 9 45717510 missense probably damaging 1.00
X0058:Dscaml1 UTSW 9 45752128 missense probably benign 0.00
Z1177:Dscaml1 UTSW 9 45672791 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACCCACACTGTTGTTAGTTCG -3'
(R):5'- TTTGCCAAGACTCCACGGAG -3'

Sequencing Primer
(F):5'- TCGAGCGATGATCACTGTGC -3'
(R):5'- GGAGCAGCAGCATATCAGTCC -3'
Posted On2015-10-21