Incidental Mutation 'R0276:Kif2a'
ID35405
Institutional Source Beutler Lab
Gene Symbol Kif2a
Ensembl Gene ENSMUSG00000021693
Gene Namekinesin family member 2A
SynonymsKns2, Kif2, M-kinesin
MMRRC Submission 038498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0276 (G1)
Quality Score138
Status Validated
Chromosome13
Chromosomal Location106958996-107022126 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 106976650 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022204] [ENSMUST00000117423] [ENSMUST00000117539] [ENSMUST00000122233] [ENSMUST00000159772]
Predicted Effect probably benign
Transcript: ENSMUST00000022204
SMART Domains Protein: ENSMUSP00000022204
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 6.56e-147 SMART
low complexity region 613 625 N/A INTRINSIC
coiled coil region 660 698 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117423
SMART Domains Protein: ENSMUSP00000113921
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 113 137 N/A INTRINSIC
KISc 174 514 6.56e-147 SMART
low complexity region 567 579 N/A INTRINSIC
coiled coil region 614 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117539
SMART Domains Protein: ENSMUSP00000113361
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
KISc 204 544 6.56e-147 SMART
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122233
SMART Domains Protein: ENSMUSP00000112715
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
KISc 193 533 4.33e-147 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
coiled coil region 671 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159772
SMART Domains Protein: ENSMUSP00000125644
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 4.33e-147 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
coiled coil region 698 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162845
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plus end-directed motor required for normal mitotic progression. The encoded protein is required for normal spindle activity during mitosis and is necessary for normal brain development. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality, abnormal lamination of the cerebral cortex, hippocampus and cerebellum, impaired neuronal migration, and abnormal axon outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,975,760 N109S possibly damaging Het
Adcy10 T A 1: 165,572,591 M1523K possibly damaging Het
Agtpbp1 C T 13: 59,462,031 S1095N possibly damaging Het
Ang2 C T 14: 51,195,518 V136I probably damaging Het
Arhgap10 A T 8: 77,413,581 M250K probably benign Het
Arhgap33 A T 7: 30,523,244 W1088R probably benign Het
Arhgef15 T C 11: 68,953,472 probably benign Het
Aspm T C 1: 139,478,471 S1699P possibly damaging Het
Atp12a C A 14: 56,387,694 D1014E probably damaging Het
Atp1a4 T A 1: 172,257,901 K45M probably damaging Het
Atp8a1 A T 5: 67,786,673 probably benign Het
Baiap3 A C 17: 25,243,687 F1099C probably damaging Het
Bcas3 T A 11: 85,470,837 probably null Het
Bms1 G A 6: 118,408,134 T371M possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Capn3 T C 2: 120,488,065 probably benign Het
Ccdc180 A G 4: 45,923,534 D1105G probably damaging Het
Ccdc33 G T 9: 58,058,392 P364Q probably damaging Het
Ccdc36 A T 9: 108,428,440 M11K possibly damaging Het
Clstn3 A G 6: 124,431,740 probably benign Het
Cntrl A T 2: 35,151,732 Y619F possibly damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Cpt1b T C 15: 89,419,959 H503R probably benign Het
Crb1 T A 1: 139,323,335 T293S possibly damaging Het
D130043K22Rik C T 13: 24,858,045 T319I possibly damaging Het
Dzip1l G A 9: 99,660,998 R502Q probably benign Het
Efcab5 A G 11: 77,129,876 M673T probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
F2rl3 A G 8: 72,762,798 T218A probably benign Het
Fam135a C T 1: 24,067,964 R31H probably damaging Het
Fam84b G T 15: 60,823,674 Y74* probably null Het
Fcer2a A T 8: 3,689,811 N53K possibly damaging Het
Gm14085 T A 2: 122,521,928 S389T probably damaging Het
Golgb1 A C 16: 36,913,876 K1162Q probably damaging Het
Gpr137b A T 13: 13,367,575 probably benign Het
Haspin A T 11: 73,136,487 L592Q probably damaging Het
Helq A G 5: 100,790,147 F478L probably damaging Het
Il17rb T A 14: 30,004,380 T84S probably damaging Het
Itga4 T C 2: 79,321,493 L880P probably damaging Het
Itih5 A G 2: 10,185,564 I61V possibly damaging Het
Ivl G A 3: 92,571,514 L415F unknown Het
Kmt2d T C 15: 98,850,311 probably benign Het
Lars2 A G 9: 123,438,121 probably benign Het
Lilrb4a T C 10: 51,491,581 V73A probably benign Het
Lrrc8a A G 2: 30,256,788 D538G possibly damaging Het
Lrrk1 G A 7: 66,296,263 probably benign Het
Mc2r A T 18: 68,408,132 I30K possibly damaging Het
Mybbp1a C A 11: 72,450,107 probably null Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ncam2 A G 16: 81,517,629 probably benign Het
Nlk T C 11: 78,571,475 I509V probably benign Het
Nlrp2 A T 7: 5,328,109 N429K probably benign Het
Nlrp9b A G 7: 20,028,498 T247A probably benign Het
Noxo1 A T 17: 24,700,162 probably null Het
Olfr1212 T A 2: 88,958,755 C96* probably null Het
Olfr139 A G 11: 74,045,118 I52T probably damaging Het
Olfr353 A T 2: 36,890,023 M275K probably benign Het
Olfr701 A T 7: 106,818,697 I205L probably benign Het
Olfr734 C A 14: 50,320,179 A219S probably benign Het
Oxr1 T C 15: 41,820,062 S294P probably damaging Het
Pfpl A G 19: 12,429,237 Y284C probably damaging Het
Pi16 A T 17: 29,326,943 T232S probably benign Het
Plcxd2 A T 16: 46,009,707 N50K probably benign Het
Plekhn1 T A 4: 156,228,246 N52Y probably damaging Het
Prl2c5 T C 13: 13,183,049 probably benign Het
Prrc2b G A 2: 32,219,654 V1080I probably damaging Het
Psg28 A T 7: 18,430,396 N130K probably benign Het
Psme4 C A 11: 30,811,980 T440K probably damaging Het
Ptcd2 T C 13: 99,321,596 K296E probably benign Het
Ptprq T C 10: 107,542,735 probably null Het
Rab5b A C 10: 128,686,746 probably null Het
Rft1 T A 14: 30,690,583 S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rsu1 A T 2: 13,170,135 probably benign Het
Senp6 A G 9: 80,136,747 M887V probably benign Het
Sgcz T A 8: 37,952,919 M60L probably benign Het
Siglec1 G A 2: 131,083,941 Q282* probably null Het
Sipa1l2 T C 8: 125,421,940 T1655A probably damaging Het
Slc43a3 G A 2: 84,937,663 probably benign Het
Snx29 T C 16: 11,738,373 V756A probably benign Het
Spta1 T A 1: 174,217,894 H1539Q probably damaging Het
Stk3 A C 15: 35,099,469 S104A probably damaging Het
Stk38 C A 17: 28,992,416 probably null Het
Stx6 T C 1: 155,174,163 probably benign Het
Thbs4 G A 13: 92,775,532 T230I probably benign Het
Thrsp A G 7: 97,417,502 M1T probably null Het
Tmem63b A T 17: 45,675,373 probably benign Het
Top2a A G 11: 99,009,907 probably benign Het
Tpd52l2 T C 2: 181,502,059 probably null Het
Trak1 A G 9: 121,454,338 E390G probably damaging Het
Trappc3 T A 4: 126,273,952 D101E possibly damaging Het
Trhr A G 15: 44,197,086 M1V probably null Het
Triobp T A 15: 78,973,676 I1159K probably benign Het
Unc45a A G 7: 80,326,297 probably benign Het
Usb1 A G 8: 95,333,457 D12G probably damaging Het
Ushbp1 C T 8: 71,394,649 C113Y possibly damaging Het
Vim A G 2: 13,574,859 K143R probably benign Het
Vmn2r75 T C 7: 86,148,307 K766R probably benign Het
Wdr92 T C 11: 17,229,821 I274T probably benign Het
Xpo5 T G 17: 46,241,507 C1089G probably damaging Het
Other mutations in Kif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Kif2a APN 13 106968793 splice site probably benign
IGL01640:Kif2a APN 13 106974552 missense probably damaging 1.00
IGL02524:Kif2a APN 13 106964355 missense possibly damaging 0.82
R0088:Kif2a UTSW 13 106975432 missense probably damaging 1.00
R1233:Kif2a UTSW 13 106987332 missense probably damaging 1.00
R1345:Kif2a UTSW 13 106993915 missense probably damaging 0.99
R1772:Kif2a UTSW 13 106978132 intron probably benign
R1900:Kif2a UTSW 13 106976995 missense possibly damaging 0.46
R1932:Kif2a UTSW 13 106978091 missense probably benign 0.00
R2364:Kif2a UTSW 13 106976836 missense probably damaging 1.00
R3177:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R3277:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R4646:Kif2a UTSW 13 106962185 missense probably damaging 1.00
R5566:Kif2a UTSW 13 106993924 splice site probably null 1.00
R5761:Kif2a UTSW 13 106962164 missense probably benign 0.05
R5797:Kif2a UTSW 13 106975376 missense probably damaging 1.00
R6812:Kif2a UTSW 13 106969751 missense probably benign 0.00
R7025:Kif2a UTSW 13 106982594 missense probably damaging 1.00
R7792:Kif2a UTSW 13 106987982 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTGTTTGCCCCACTACAAAAGCC -3'
(R):5'- AGCCATGCAGTGTTCCAGATCATTC -3'

Sequencing Primer
(F):5'- CTTTTACAATCTAGCTGAGCAACCG -3'
(R):5'- GCAGTGTTCCAGATCATTCTAAGAAG -3'
Posted On2013-05-09