Incidental Mutation 'R0276:Rft1'
ID 35407
Institutional Source Beutler Lab
Gene Symbol Rft1
Ensembl Gene ENSMUSG00000052395
Gene Name RFT1 homolog
Synonyms
MMRRC Submission 038498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0276 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 30654360-30691317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30690583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 534 (S534T)
Ref Sequence ENSEMBL: ENSMUSP00000064153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064230] [ENSMUST00000226817] [ENSMUST00000228686]
AlphaFold Q8C3B8
Predicted Effect probably benign
Transcript: ENSMUST00000064230
AA Change: S534T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064153
Gene: ENSMUSG00000052395
AA Change: S534T

DomainStartEndE-ValueType
Pfam:Rft-1 9 530 2.2e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226805
Predicted Effect probably benign
Transcript: ENSMUST00000226817
Predicted Effect probably benign
Transcript: ENSMUST00000228686
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the translocation of the Man(5)GlcNAc (2)-PP-Dol intermediate from the cytoplasmic to the luminal side of the endoplasmic reticulum membrane in the pathway for the N-glycosylation of proteins. Mutations in this gene are associated with congenital disorder of glycosylation type In.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,975,760 N109S possibly damaging Het
Adcy10 T A 1: 165,572,591 M1523K possibly damaging Het
Agtpbp1 C T 13: 59,462,031 S1095N possibly damaging Het
Ang2 C T 14: 51,195,518 V136I probably damaging Het
Arhgap10 A T 8: 77,413,581 M250K probably benign Het
Arhgap33 A T 7: 30,523,244 W1088R probably benign Het
Arhgef15 T C 11: 68,953,472 probably benign Het
Aspm T C 1: 139,478,471 S1699P possibly damaging Het
Atp12a C A 14: 56,387,694 D1014E probably damaging Het
Atp1a4 T A 1: 172,257,901 K45M probably damaging Het
Atp8a1 A T 5: 67,786,673 probably benign Het
Baiap3 A C 17: 25,243,687 F1099C probably damaging Het
Bcas3 T A 11: 85,470,837 probably null Het
Bms1 G A 6: 118,408,134 T371M possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Capn3 T C 2: 120,488,065 probably benign Het
Ccdc180 A G 4: 45,923,534 D1105G probably damaging Het
Ccdc33 G T 9: 58,058,392 P364Q probably damaging Het
Ccdc36 A T 9: 108,428,440 M11K possibly damaging Het
Clstn3 A G 6: 124,431,740 probably benign Het
Cntrl A T 2: 35,151,732 Y619F possibly damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Cpt1b T C 15: 89,419,959 H503R probably benign Het
Crb1 T A 1: 139,323,335 T293S possibly damaging Het
D130043K22Rik C T 13: 24,858,045 T319I possibly damaging Het
Dzip1l G A 9: 99,660,998 R502Q probably benign Het
Efcab5 A G 11: 77,129,876 M673T probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
F2rl3 A G 8: 72,762,798 T218A probably benign Het
Fam135a C T 1: 24,067,964 R31H probably damaging Het
Fam84b G T 15: 60,823,674 Y74* probably null Het
Fcer2a A T 8: 3,689,811 N53K possibly damaging Het
Gm14085 T A 2: 122,521,928 S389T probably damaging Het
Golgb1 A C 16: 36,913,876 K1162Q probably damaging Het
Gpr137b A T 13: 13,367,575 probably benign Het
Haspin A T 11: 73,136,487 L592Q probably damaging Het
Helq A G 5: 100,790,147 F478L probably damaging Het
Il17rb T A 14: 30,004,380 T84S probably damaging Het
Itga4 T C 2: 79,321,493 L880P probably damaging Het
Itih5 A G 2: 10,185,564 I61V possibly damaging Het
Ivl G A 3: 92,571,514 L415F unknown Het
Kif2a A G 13: 106,976,650 probably benign Het
Kmt2d T C 15: 98,850,311 probably benign Het
Lars2 A G 9: 123,438,121 probably benign Het
Lilrb4a T C 10: 51,491,581 V73A probably benign Het
Lrrc8a A G 2: 30,256,788 D538G possibly damaging Het
Lrrk1 G A 7: 66,296,263 probably benign Het
Mc2r A T 18: 68,408,132 I30K possibly damaging Het
Mybbp1a C A 11: 72,450,107 probably null Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ncam2 A G 16: 81,517,629 probably benign Het
Nlk T C 11: 78,571,475 I509V probably benign Het
Nlrp2 A T 7: 5,328,109 N429K probably benign Het
Nlrp9b A G 7: 20,028,498 T247A probably benign Het
Noxo1 A T 17: 24,700,162 probably null Het
Olfr1212 T A 2: 88,958,755 C96* probably null Het
Olfr139 A G 11: 74,045,118 I52T probably damaging Het
Olfr353 A T 2: 36,890,023 M275K probably benign Het
Olfr701 A T 7: 106,818,697 I205L probably benign Het
Olfr734 C A 14: 50,320,179 A219S probably benign Het
Oxr1 T C 15: 41,820,062 S294P probably damaging Het
Pfpl A G 19: 12,429,237 Y284C probably damaging Het
Pi16 A T 17: 29,326,943 T232S probably benign Het
Plcxd2 A T 16: 46,009,707 N50K probably benign Het
Plekhn1 T A 4: 156,228,246 N52Y probably damaging Het
Prl2c5 T C 13: 13,183,049 probably benign Het
Prrc2b G A 2: 32,219,654 V1080I probably damaging Het
Psg28 A T 7: 18,430,396 N130K probably benign Het
Psme4 C A 11: 30,811,980 T440K probably damaging Het
Ptcd2 T C 13: 99,321,596 K296E probably benign Het
Ptprq T C 10: 107,542,735 probably null Het
Rab5b A C 10: 128,686,746 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rsu1 A T 2: 13,170,135 probably benign Het
Senp6 A G 9: 80,136,747 M887V probably benign Het
Sgcz T A 8: 37,952,919 M60L probably benign Het
Siglec1 G A 2: 131,083,941 Q282* probably null Het
Sipa1l2 T C 8: 125,421,940 T1655A probably damaging Het
Slc43a3 G A 2: 84,937,663 probably benign Het
Snx29 T C 16: 11,738,373 V756A probably benign Het
Spta1 T A 1: 174,217,894 H1539Q probably damaging Het
Stk3 A C 15: 35,099,469 S104A probably damaging Het
Stk38 C A 17: 28,992,416 probably null Het
Stx6 T C 1: 155,174,163 probably benign Het
Thbs4 G A 13: 92,775,532 T230I probably benign Het
Thrsp A G 7: 97,417,502 M1T probably null Het
Tmem63b A T 17: 45,675,373 probably benign Het
Top2a A G 11: 99,009,907 probably benign Het
Tpd52l2 T C 2: 181,502,059 probably null Het
Trak1 A G 9: 121,454,338 E390G probably damaging Het
Trappc3 T A 4: 126,273,952 D101E possibly damaging Het
Trhr A G 15: 44,197,086 M1V probably null Het
Triobp T A 15: 78,973,676 I1159K probably benign Het
Unc45a A G 7: 80,326,297 probably benign Het
Usb1 A G 8: 95,333,457 D12G probably damaging Het
Ushbp1 C T 8: 71,394,649 C113Y possibly damaging Het
Vim A G 2: 13,574,859 K143R probably benign Het
Vmn2r75 T C 7: 86,148,307 K766R probably benign Het
Wdr92 T C 11: 17,229,821 I274T probably benign Het
Xpo5 T G 17: 46,241,507 C1089G probably damaging Het
Other mutations in Rft1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Rft1 APN 14 30676896 missense possibly damaging 0.71
IGL01642:Rft1 APN 14 30676868 missense probably damaging 1.00
IGL01654:Rft1 APN 14 30676880 missense probably damaging 0.99
IGL01970:Rft1 APN 14 30690535 missense probably benign
IGL02403:Rft1 APN 14 30660321 splice site probably benign
IGL02928:Rft1 APN 14 30663115 missense possibly damaging 0.78
IGL03186:Rft1 APN 14 30658349 missense possibly damaging 0.90
IGL03286:Rft1 APN 14 30661366 missense probably benign 0.00
R0879:Rft1 UTSW 14 30682748 splice site probably benign
R1491:Rft1 UTSW 14 30666787 nonsense probably null
R2423:Rft1 UTSW 14 30666767 missense possibly damaging 0.49
R3693:Rft1 UTSW 14 30690451 missense probably damaging 1.00
R4543:Rft1 UTSW 14 30661333 missense probably benign 0.24
R4611:Rft1 UTSW 14 30689790 missense probably damaging 0.98
R4878:Rft1 UTSW 14 30677804 missense probably benign 0.04
R5256:Rft1 UTSW 14 30661286 missense probably benign 0.03
R5382:Rft1 UTSW 14 30666782 missense probably benign 0.04
R5719:Rft1 UTSW 14 30663226 intron probably benign
R7200:Rft1 UTSW 14 30682857 critical splice donor site probably null
R7652:Rft1 UTSW 14 30677816 missense probably benign 0.15
R7657:Rft1 UTSW 14 30666767 missense probably damaging 1.00
R7851:Rft1 UTSW 14 30690583 missense probably benign 0.00
R8341:Rft1 UTSW 14 30689881 missense probably damaging 1.00
R8777:Rft1 UTSW 14 30660199 missense probably damaging 1.00
R8777-TAIL:Rft1 UTSW 14 30660199 missense probably damaging 1.00
R9288:Rft1 UTSW 14 30661458 nonsense probably null
R9301:Rft1 UTSW 14 30676855 missense probably damaging 1.00
R9427:Rft1 UTSW 14 30689824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGCCTTGTATCTGACTTAGAAGC -3'
(R):5'- AAGCCTTGGACTGGAGATCTGTCCTC -3'

Sequencing Primer
(F):5'- aaggcacagggcaacac -3'
(R):5'- ACTGGAGATCTGTCCTCTGTAGTC -3'
Posted On 2013-05-09