Incidental Mutation 'R4717:Zfp442'
ID354102
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Namezinc finger protein 442
SynonymsOTTMUSG00000015730
MMRRC Submission 041984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4717 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150407141-150451486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150408229 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 527 (F527L)
Ref Sequence ENSEMBL: ENSMUSP00000140098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
Predicted Effect probably benign
Transcript: ENSMUST00000109916
AA Change: F584L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: F584L

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: F527L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: F527L

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,221,787 L60P probably damaging Het
Acsf2 T G 11: 94,559,546 M512L probably benign Het
Ahrr T A 13: 74,215,766 H312L probably benign Het
Akr1c18 T C 13: 4,136,718 M244V probably benign Het
Aldh3b2 A G 19: 3,981,128 Y459C probably damaging Het
Arhgap29 A T 3: 122,009,958 I796L possibly damaging Het
Arrdc4 T A 7: 68,741,658 D287V probably damaging Het
Astn2 A T 4: 65,644,754 I930N possibly damaging Het
Bace2 T A 16: 97,436,873 L508Q probably damaging Het
Baz2a G T 10: 128,124,942 C1537F possibly damaging Het
Cad A G 5: 31,066,686 probably null Het
Capn5 A T 7: 98,123,919 I626N probably benign Het
Car8 A T 4: 8,169,685 N274K probably damaging Het
Casp14 T C 10: 78,715,124 I76V probably benign Het
Ccdc88c A G 12: 100,916,666 V1649A probably benign Het
Cemip A T 7: 83,947,280 I1092N probably damaging Het
Clspn A G 4: 126,560,056 N91D probably damaging Het
Cpxm2 A G 7: 132,054,845 Y563H possibly damaging Het
Csnk1g2 T C 10: 80,637,915 V72A probably benign Het
Cyp46a1 T C 12: 108,352,026 probably null Het
Cyp4x1 T C 4: 115,121,705 H206R probably benign Het
Dapk1 T A 13: 60,726,662 probably null Het
Ddx1 A G 12: 13,240,887 W76R probably damaging Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah2 T C 11: 69,429,357 D3962G probably benign Het
Dnajc14 T A 10: 128,806,244 C12S possibly damaging Het
Dock1 T C 7: 134,848,170 I804T probably damaging Het
Efs G T 14: 54,920,344 S170Y probably damaging Het
Eml4 G T 17: 83,448,225 W295C probably benign Het
Fkbp15 A G 4: 62,308,069 S748P probably damaging Het
Ghr T G 15: 3,319,753 I648L possibly damaging Het
Gigyf1 T A 5: 137,525,232 I942N probably damaging Het
Gm960 A G 19: 4,625,873 probably benign Het
Gpam T A 19: 55,075,614 E682D probably benign Het
Gsr A T 8: 33,693,858 K383* probably null Het
Hapln1 C A 13: 89,605,460 S248R probably benign Het
Haus2 G T 2: 120,619,102 R209L probably benign Het
Hhatl A G 9: 121,789,877 F63S probably damaging Het
Hmcn1 A G 1: 150,619,065 M4091T probably benign Het
Hspb7 A G 4: 141,422,585 D94G probably damaging Het
Irf6 T A 1: 193,167,434 probably null Het
Itgb2 T A 10: 77,546,044 L60* probably null Het
Jmjd1c C T 10: 67,158,051 Q104* probably null Het
Kcnh1 A G 1: 192,276,717 D193G probably damaging Het
Klhl25 G T 7: 75,866,780 C478F probably damaging Het
Klhl3 T C 13: 58,030,516 D267G probably damaging Het
L3mbtl4 T G 17: 68,455,713 H80Q probably null Het
Lhcgr C A 17: 88,742,467 V544F probably benign Het
Mfsd4a T C 1: 132,057,895 N168D probably benign Het
Mmp3 A G 9: 7,449,881 Q255R possibly damaging Het
Mrgprb3 C A 7: 48,643,252 G184C probably benign Het
Mtpap C T 18: 4,396,394 A562V possibly damaging Het
Nid1 T C 13: 13,506,501 V1072A probably benign Het
Nsf T G 11: 103,823,769 K728T probably damaging Het
Olfr1328 T C 4: 118,934,429 N140D probably benign Het
Olfr23 T A 11: 73,940,815 S190T possibly damaging Het
Olfr448 T C 6: 42,897,224 Y258H probably damaging Het
Olfr530 T C 7: 140,373,415 N65S probably damaging Het
Olfr725 A T 14: 50,035,364 V13E probably damaging Het
Pcsk5 A T 19: 17,525,267 C894S probably damaging Het
Pde2a A G 7: 101,494,672 D166G probably benign Het
Pfpl G A 19: 12,429,254 E290K probably benign Het
Pi4kb A C 3: 94,998,851 I570L probably damaging Het
Plxnb2 A T 15: 89,157,419 C1727* probably null Het
Poln A T 5: 34,129,448 D125E possibly damaging Het
Pomgnt1 A G 4: 116,154,215 D259G possibly damaging Het
Prx A T 7: 27,516,727 M218L probably benign Het
Pxn A T 5: 115,551,942 Q342L probably damaging Het
Rhpn2 A G 7: 35,334,350 D3G possibly damaging Het
Rnase2b C T 14: 51,162,717 T85I possibly damaging Het
Rnaseh2b C A 14: 62,353,626 T142K probably damaging Het
Sacs T C 14: 61,212,855 S4117P probably damaging Het
Sdk2 T C 11: 113,854,369 N700S probably damaging Het
Sec62 A C 3: 30,809,871 K101Q unknown Het
Sel1l2 A C 2: 140,230,023 L659R possibly damaging Het
Sept11 A G 5: 93,156,956 I211V possibly damaging Het
Slc25a42 C T 8: 70,189,457 E112K probably damaging Het
Spem2 T C 11: 69,817,783 N119D probably benign Het
Themis G A 10: 28,789,752 E604K probably benign Het
Tie1 T C 4: 118,486,217 K150E probably damaging Het
Ubap2 G A 4: 41,218,333 T258I possibly damaging Het
Ushbp1 C T 8: 71,385,669 A664T probably damaging Het
Vmn1r1 T C 1: 182,157,209 N297S possibly damaging Het
Vmn1r173 A C 7: 23,703,212 I291L probably damaging Het
Yy1 A G 12: 108,794,046 I212V possibly damaging Het
Zyg11b T A 4: 108,241,872 H632L probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAATGTACAAAGGCTTCACCA -3'
(R):5'- GGGTTTCAAAGTGGTCTGCA -3'

Sequencing Primer
(F):5'- CTCTGAAGATGTCTGACATGCCAAG -3'
(R):5'- GTGATAAGGCATTTGCATGTCAAGC -3'
Posted On2015-10-21