Incidental Mutation 'R4717:Astn2'
ID354110
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Nameastrotactin 2
Synonyms1d8, Astnl
MMRRC Submission 041984-MU
Accession Numbers

Genbank: NM_019514.3, NM_207109.2; Ensembl: ENSMUST00000068214,   ENSMUST00000084496

Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4717 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location65380803-66404611 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65644754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 930 (I930N)
Ref Sequence ENSEMBL: ENSMUSP00000065786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068214
AA Change: I930N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: I930N

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084496
AA Change: I878N

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: I878N

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,221,787 L60P probably damaging Het
Acsf2 T G 11: 94,559,546 M512L probably benign Het
Ahrr T A 13: 74,215,766 H312L probably benign Het
Akr1c18 T C 13: 4,136,718 M244V probably benign Het
Aldh3b2 A G 19: 3,981,128 Y459C probably damaging Het
Arhgap29 A T 3: 122,009,958 I796L possibly damaging Het
Arrdc4 T A 7: 68,741,658 D287V probably damaging Het
Bace2 T A 16: 97,436,873 L508Q probably damaging Het
Baz2a G T 10: 128,124,942 C1537F possibly damaging Het
Cad A G 5: 31,066,686 probably null Het
Capn5 A T 7: 98,123,919 I626N probably benign Het
Car8 A T 4: 8,169,685 N274K probably damaging Het
Casp14 T C 10: 78,715,124 I76V probably benign Het
Ccdc88c A G 12: 100,916,666 V1649A probably benign Het
Cemip A T 7: 83,947,280 I1092N probably damaging Het
Clspn A G 4: 126,560,056 N91D probably damaging Het
Cpxm2 A G 7: 132,054,845 Y563H possibly damaging Het
Csnk1g2 T C 10: 80,637,915 V72A probably benign Het
Cyp46a1 T C 12: 108,352,026 probably null Het
Cyp4x1 T C 4: 115,121,705 H206R probably benign Het
Dapk1 T A 13: 60,726,662 probably null Het
Ddx1 A G 12: 13,240,887 W76R probably damaging Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah2 T C 11: 69,429,357 D3962G probably benign Het
Dnajc14 T A 10: 128,806,244 C12S possibly damaging Het
Dock1 T C 7: 134,848,170 I804T probably damaging Het
Efs G T 14: 54,920,344 S170Y probably damaging Het
Eml4 G T 17: 83,448,225 W295C probably benign Het
Fkbp15 A G 4: 62,308,069 S748P probably damaging Het
Ghr T G 15: 3,319,753 I648L possibly damaging Het
Gigyf1 T A 5: 137,525,232 I942N probably damaging Het
Gm960 A G 19: 4,625,873 probably benign Het
Gpam T A 19: 55,075,614 E682D probably benign Het
Gsr A T 8: 33,693,858 K383* probably null Het
Hapln1 C A 13: 89,605,460 S248R probably benign Het
Haus2 G T 2: 120,619,102 R209L probably benign Het
Hhatl A G 9: 121,789,877 F63S probably damaging Het
Hmcn1 A G 1: 150,619,065 M4091T probably benign Het
Hspb7 A G 4: 141,422,585 D94G probably damaging Het
Irf6 T A 1: 193,167,434 probably null Het
Itgb2 T A 10: 77,546,044 L60* probably null Het
Jmjd1c C T 10: 67,158,051 Q104* probably null Het
Kcnh1 A G 1: 192,276,717 D193G probably damaging Het
Klhl25 G T 7: 75,866,780 C478F probably damaging Het
Klhl3 T C 13: 58,030,516 D267G probably damaging Het
L3mbtl4 T G 17: 68,455,713 H80Q probably null Het
Lhcgr C A 17: 88,742,467 V544F probably benign Het
Mfsd4a T C 1: 132,057,895 N168D probably benign Het
Mmp3 A G 9: 7,449,881 Q255R possibly damaging Het
Mrgprb3 C A 7: 48,643,252 G184C probably benign Het
Mtpap C T 18: 4,396,394 A562V possibly damaging Het
Nid1 T C 13: 13,506,501 V1072A probably benign Het
Nsf T G 11: 103,823,769 K728T probably damaging Het
Olfr1328 T C 4: 118,934,429 N140D probably benign Het
Olfr23 T A 11: 73,940,815 S190T possibly damaging Het
Olfr448 T C 6: 42,897,224 Y258H probably damaging Het
Olfr530 T C 7: 140,373,415 N65S probably damaging Het
Olfr725 A T 14: 50,035,364 V13E probably damaging Het
Pcsk5 A T 19: 17,525,267 C894S probably damaging Het
Pde2a A G 7: 101,494,672 D166G probably benign Het
Pfpl G A 19: 12,429,254 E290K probably benign Het
Pi4kb A C 3: 94,998,851 I570L probably damaging Het
Plxnb2 A T 15: 89,157,419 C1727* probably null Het
Poln A T 5: 34,129,448 D125E possibly damaging Het
Pomgnt1 A G 4: 116,154,215 D259G possibly damaging Het
Prx A T 7: 27,516,727 M218L probably benign Het
Pxn A T 5: 115,551,942 Q342L probably damaging Het
Rhpn2 A G 7: 35,334,350 D3G possibly damaging Het
Rnase2b C T 14: 51,162,717 T85I possibly damaging Het
Rnaseh2b C A 14: 62,353,626 T142K probably damaging Het
Sacs T C 14: 61,212,855 S4117P probably damaging Het
Sdk2 T C 11: 113,854,369 N700S probably damaging Het
Sec62 A C 3: 30,809,871 K101Q unknown Het
Sel1l2 A C 2: 140,230,023 L659R possibly damaging Het
Sept11 A G 5: 93,156,956 I211V possibly damaging Het
Slc25a42 C T 8: 70,189,457 E112K probably damaging Het
Spem2 T C 11: 69,817,783 N119D probably benign Het
Themis G A 10: 28,789,752 E604K probably benign Het
Tie1 T C 4: 118,486,217 K150E probably damaging Het
Ubap2 G A 4: 41,218,333 T258I possibly damaging Het
Ushbp1 C T 8: 71,385,669 A664T probably damaging Het
Vmn1r1 T C 1: 182,157,209 N297S possibly damaging Het
Vmn1r173 A C 7: 23,703,212 I291L probably damaging Het
Yy1 A G 12: 108,794,046 I212V possibly damaging Het
Zfp442 A T 2: 150,408,229 F527L probably damaging Het
Zyg11b T A 4: 108,241,872 H632L probably damaging Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66185187 missense unknown
IGL01657:Astn2 APN 4 65651949 missense probably damaging 0.99
IGL01747:Astn2 APN 4 65794618 missense probably benign 0.17
IGL02008:Astn2 APN 4 66059153 missense probably damaging 1.00
IGL02215:Astn2 APN 4 66266234 missense unknown
IGL02484:Astn2 APN 4 65992279 splice site probably benign
IGL02494:Astn2 APN 4 65992348 missense probably benign 0.23
IGL02792:Astn2 APN 4 65644821 missense probably benign 0.32
IGL03248:Astn2 APN 4 65746293 splice site probably benign
IGL03409:Astn2 APN 4 65435186 missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65992387 missense probably damaging 0.99
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66403982 missense unknown
R0245:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0528:Astn2 UTSW 4 65644882 splice site probably benign
R0586:Astn2 UTSW 4 66185142 missense unknown
R0652:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0880:Astn2 UTSW 4 65648330 missense probably damaging 0.99
R0931:Astn2 UTSW 4 65648293 missense probably damaging 0.99
R1353:Astn2 UTSW 4 66266335 missense unknown
R1700:Astn2 UTSW 4 65746354 nonsense probably null
R1934:Astn2 UTSW 4 65435189 missense probably damaging 0.99
R2017:Astn2 UTSW 4 65540941 missense probably damaging 0.99
R2101:Astn2 UTSW 4 65581686 nonsense probably null
R2158:Astn2 UTSW 4 66404254 missense unknown
R2907:Astn2 UTSW 4 65644856 missense possibly damaging 0.92
R2923:Astn2 UTSW 4 65913773 missense probably damaging 1.00
R2938:Astn2 UTSW 4 65992313 missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65644706 missense probably damaging 1.00
R3933:Astn2 UTSW 4 66403955 missense unknown
R4151:Astn2 UTSW 4 65729320 critical splice donor site probably null
R4230:Astn2 UTSW 4 65911682 missense probably damaging 0.99
R4497:Astn2 UTSW 4 66119063 intron probably benign
R4844:Astn2 UTSW 4 65644730 missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65729407 missense probably damaging 0.98
R5374:Astn2 UTSW 4 65397005 missense probably damaging 0.96
R5442:Astn2 UTSW 4 65581786 missense possibly damaging 0.86
R5694:Astn2 UTSW 4 65950138 missense probably damaging 1.00
R5756:Astn2 UTSW 4 66119188 intron probably benign
R5763:Astn2 UTSW 4 65729331 missense probably benign 0.14
R6089:Astn2 UTSW 4 65794573 missense probably damaging 0.96
R6990:Astn2 UTSW 4 65992303 missense possibly damaging 0.82
R7304:Astn2 UTSW 4 66185375 missense unknown
R7325:Astn2 UTSW 4 65542669 missense probably benign 0.33
R7356:Astn2 UTSW 4 66185266 missense unknown
R7414:Astn2 UTSW 4 65540956 missense possibly damaging 0.85
R7755:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R7887:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R7970:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R8027:Astn2 UTSW 4 65540971 missense possibly damaging 0.86
R8046:Astn2 UTSW 4 66266350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGGGAATTGCCAAAGC -3'
(R):5'- AAGGCCGCATAACCTAGCTG -3'

Sequencing Primer
(F):5'- GGGAATTGCCAAAGCCCACC -3'
(R):5'- GACTGGCATACACATTTTTGGC -3'
Posted On2015-10-21