Incidental Mutation 'R4717:Cyp4x1'
ID354111
Institutional Source Beutler Lab
Gene Symbol Cyp4x1
Ensembl Gene ENSMUSG00000047155
Gene Namecytochrome P450, family 4, subfamily x, polypeptide 1
SynonymsCyp4a28-ps
MMRRC Submission 041984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4717 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115106323-115134281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115121705 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 206 (H206R)
Ref Sequence ENSEMBL: ENSMUSP00000102155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051400] [ENSMUST00000106545]
Predicted Effect probably benign
Transcript: ENSMUST00000051400
AA Change: H232R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059545
Gene: ENSMUSG00000047155
AA Change: H232R

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
Pfam:p450 46 501 1.5e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106545
AA Change: H206R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102155
Gene: ENSMUSG00000047155
AA Change: H206R

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:p450 20 475 4.7e-118 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes and is located within a cluster of genes belonging to this superfamily on chromosome 1. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The expression pattern of a similar rat protein suggests that this protein may be involved in neurovascular function in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,221,787 L60P probably damaging Het
Acsf2 T G 11: 94,559,546 M512L probably benign Het
Ahrr T A 13: 74,215,766 H312L probably benign Het
Akr1c18 T C 13: 4,136,718 M244V probably benign Het
Aldh3b2 A G 19: 3,981,128 Y459C probably damaging Het
Arhgap29 A T 3: 122,009,958 I796L possibly damaging Het
Arrdc4 T A 7: 68,741,658 D287V probably damaging Het
Astn2 A T 4: 65,644,754 I930N possibly damaging Het
Bace2 T A 16: 97,436,873 L508Q probably damaging Het
Baz2a G T 10: 128,124,942 C1537F possibly damaging Het
Cad A G 5: 31,066,686 probably null Het
Capn5 A T 7: 98,123,919 I626N probably benign Het
Car8 A T 4: 8,169,685 N274K probably damaging Het
Casp14 T C 10: 78,715,124 I76V probably benign Het
Ccdc88c A G 12: 100,916,666 V1649A probably benign Het
Cemip A T 7: 83,947,280 I1092N probably damaging Het
Clspn A G 4: 126,560,056 N91D probably damaging Het
Cpxm2 A G 7: 132,054,845 Y563H possibly damaging Het
Csnk1g2 T C 10: 80,637,915 V72A probably benign Het
Cyp46a1 T C 12: 108,352,026 probably null Het
Dapk1 T A 13: 60,726,662 probably null Het
Ddx1 A G 12: 13,240,887 W76R probably damaging Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah2 T C 11: 69,429,357 D3962G probably benign Het
Dnajc14 T A 10: 128,806,244 C12S possibly damaging Het
Dock1 T C 7: 134,848,170 I804T probably damaging Het
Efs G T 14: 54,920,344 S170Y probably damaging Het
Eml4 G T 17: 83,448,225 W295C probably benign Het
Fkbp15 A G 4: 62,308,069 S748P probably damaging Het
Ghr T G 15: 3,319,753 I648L possibly damaging Het
Gigyf1 T A 5: 137,525,232 I942N probably damaging Het
Gm960 A G 19: 4,625,873 probably benign Het
Gpam T A 19: 55,075,614 E682D probably benign Het
Gsr A T 8: 33,693,858 K383* probably null Het
Hapln1 C A 13: 89,605,460 S248R probably benign Het
Haus2 G T 2: 120,619,102 R209L probably benign Het
Hhatl A G 9: 121,789,877 F63S probably damaging Het
Hmcn1 A G 1: 150,619,065 M4091T probably benign Het
Hspb7 A G 4: 141,422,585 D94G probably damaging Het
Irf6 T A 1: 193,167,434 probably null Het
Itgb2 T A 10: 77,546,044 L60* probably null Het
Jmjd1c C T 10: 67,158,051 Q104* probably null Het
Kcnh1 A G 1: 192,276,717 D193G probably damaging Het
Klhl25 G T 7: 75,866,780 C478F probably damaging Het
Klhl3 T C 13: 58,030,516 D267G probably damaging Het
L3mbtl4 T G 17: 68,455,713 H80Q probably null Het
Lhcgr C A 17: 88,742,467 V544F probably benign Het
Mfsd4a T C 1: 132,057,895 N168D probably benign Het
Mmp3 A G 9: 7,449,881 Q255R possibly damaging Het
Mrgprb3 C A 7: 48,643,252 G184C probably benign Het
Mtpap C T 18: 4,396,394 A562V possibly damaging Het
Nid1 T C 13: 13,506,501 V1072A probably benign Het
Nsf T G 11: 103,823,769 K728T probably damaging Het
Olfr1328 T C 4: 118,934,429 N140D probably benign Het
Olfr23 T A 11: 73,940,815 S190T possibly damaging Het
Olfr448 T C 6: 42,897,224 Y258H probably damaging Het
Olfr530 T C 7: 140,373,415 N65S probably damaging Het
Olfr725 A T 14: 50,035,364 V13E probably damaging Het
Pcsk5 A T 19: 17,525,267 C894S probably damaging Het
Pde2a A G 7: 101,494,672 D166G probably benign Het
Pfpl G A 19: 12,429,254 E290K probably benign Het
Pi4kb A C 3: 94,998,851 I570L probably damaging Het
Plxnb2 A T 15: 89,157,419 C1727* probably null Het
Poln A T 5: 34,129,448 D125E possibly damaging Het
Pomgnt1 A G 4: 116,154,215 D259G possibly damaging Het
Prx A T 7: 27,516,727 M218L probably benign Het
Pxn A T 5: 115,551,942 Q342L probably damaging Het
Rhpn2 A G 7: 35,334,350 D3G possibly damaging Het
Rnase2b C T 14: 51,162,717 T85I possibly damaging Het
Rnaseh2b C A 14: 62,353,626 T142K probably damaging Het
Sacs T C 14: 61,212,855 S4117P probably damaging Het
Sdk2 T C 11: 113,854,369 N700S probably damaging Het
Sec62 A C 3: 30,809,871 K101Q unknown Het
Sel1l2 A C 2: 140,230,023 L659R possibly damaging Het
Sept11 A G 5: 93,156,956 I211V possibly damaging Het
Slc25a42 C T 8: 70,189,457 E112K probably damaging Het
Spem2 T C 11: 69,817,783 N119D probably benign Het
Themis G A 10: 28,789,752 E604K probably benign Het
Tie1 T C 4: 118,486,217 K150E probably damaging Het
Ubap2 G A 4: 41,218,333 T258I possibly damaging Het
Ushbp1 C T 8: 71,385,669 A664T probably damaging Het
Vmn1r1 T C 1: 182,157,209 N297S possibly damaging Het
Vmn1r173 A C 7: 23,703,212 I291L probably damaging Het
Yy1 A G 12: 108,794,046 I212V possibly damaging Het
Zfp442 A T 2: 150,408,229 F527L probably damaging Het
Zyg11b T A 4: 108,241,872 H632L probably damaging Het
Other mutations in Cyp4x1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cyp4x1 APN 4 115121948 missense probably benign 0.00
IGL00913:Cyp4x1 APN 4 115112863 missense probably benign 0.19
IGL02990:Cyp4x1 APN 4 115121749 missense probably benign 0.02
IGL03411:Cyp4x1 APN 4 115108785 missense probably benign 0.05
R0607:Cyp4x1 UTSW 4 115112826 missense probably damaging 1.00
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1426:Cyp4x1 UTSW 4 115112791 splice site probably benign
R1484:Cyp4x1 UTSW 4 115112901 missense probably damaging 1.00
R1675:Cyp4x1 UTSW 4 115127560 missense possibly damaging 0.94
R1718:Cyp4x1 UTSW 4 115111670 missense possibly damaging 0.75
R2208:Cyp4x1 UTSW 4 115126594 missense probably benign 0.01
R2325:Cyp4x1 UTSW 4 115124379 missense probably benign 0.40
R4223:Cyp4x1 UTSW 4 115112880 missense probably damaging 0.98
R4588:Cyp4x1 UTSW 4 115108797 missense probably damaging 1.00
R5522:Cyp4x1 UTSW 4 115121977 missense probably damaging 1.00
R5880:Cyp4x1 UTSW 4 115108721 missense possibly damaging 0.62
R5994:Cyp4x1 UTSW 4 115121945 missense probably benign
R6103:Cyp4x1 UTSW 4 115111667 missense probably damaging 1.00
R7733:Cyp4x1 UTSW 4 115120194 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGAACAGTGATCATGTTAAAGCTCC -3'
(R):5'- TTTGGCCAGGAGACCAACTG -3'

Sequencing Primer
(F):5'- TGTTAAAGCTCCATTAAGAACAGGAG -3'
(R):5'- ACTGCCAGATAAACGGGTC -3'
Posted On2015-10-21