Incidental Mutation 'R4717:Capn5'
ID 354131
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 041984-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4717 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97773126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 626 (I626N)
Ref Sequence ENSEMBL: ENSMUSP00000102729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627]
AlphaFold O08688
Predicted Effect probably benign
Transcript: ENSMUST00000040971
AA Change: I626N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: I626N

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107112
AA Change: I626N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: I626N

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131632
Predicted Effect probably benign
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,097,783 (GRCm39) L60P probably damaging Het
Acsf2 T G 11: 94,450,372 (GRCm39) M512L probably benign Het
Ahrr T A 13: 74,363,885 (GRCm39) H312L probably benign Het
Akr1c18 T C 13: 4,186,717 (GRCm39) M244V probably benign Het
Aldh3b2 A G 19: 4,031,128 (GRCm39) Y459C probably damaging Het
Arhgap29 A T 3: 121,803,607 (GRCm39) I796L possibly damaging Het
Arrdc4 T A 7: 68,391,406 (GRCm39) D287V probably damaging Het
Astn2 A T 4: 65,562,991 (GRCm39) I930N possibly damaging Het
Bace2 T A 16: 97,238,073 (GRCm39) L508Q probably damaging Het
Baz2a G T 10: 127,960,811 (GRCm39) C1537F possibly damaging Het
Cad A G 5: 31,224,030 (GRCm39) probably null Het
Car8 A T 4: 8,169,685 (GRCm39) N274K probably damaging Het
Casp14 T C 10: 78,550,958 (GRCm39) I76V probably benign Het
Ccdc88c A G 12: 100,882,925 (GRCm39) V1649A probably benign Het
Cemip A T 7: 83,596,488 (GRCm39) I1092N probably damaging Het
Clspn A G 4: 126,453,849 (GRCm39) N91D probably damaging Het
Cpxm2 A G 7: 131,656,574 (GRCm39) Y563H possibly damaging Het
Csnk1g2 T C 10: 80,473,749 (GRCm39) V72A probably benign Het
Cyp46a1 T C 12: 108,318,285 (GRCm39) probably null Het
Cyp4x1 T C 4: 114,978,902 (GRCm39) H206R probably benign Het
Dapk1 T A 13: 60,874,476 (GRCm39) probably null Het
Ddx1 A G 12: 13,290,888 (GRCm39) W76R probably damaging Het
Dhx29 G A 13: 113,083,469 (GRCm39) R508H unknown Het
Dnah2 T C 11: 69,320,183 (GRCm39) D3962G probably benign Het
Dnajc14 T A 10: 128,642,113 (GRCm39) C12S possibly damaging Het
Dock1 T C 7: 134,449,899 (GRCm39) I804T probably damaging Het
Efs G T 14: 55,157,801 (GRCm39) S170Y probably damaging Het
Eml4 G T 17: 83,755,654 (GRCm39) W295C probably benign Het
Fkbp15 A G 4: 62,226,306 (GRCm39) S748P probably damaging Het
Ghr T G 15: 3,349,235 (GRCm39) I648L possibly damaging Het
Gigyf1 T A 5: 137,523,494 (GRCm39) I942N probably damaging Het
Gpam T A 19: 55,064,046 (GRCm39) E682D probably benign Het
Gsr A T 8: 34,183,886 (GRCm39) K383* probably null Het
Hapln1 C A 13: 89,753,579 (GRCm39) S248R probably benign Het
Haus2 G T 2: 120,449,583 (GRCm39) R209L probably benign Het
Hhatl A G 9: 121,618,943 (GRCm39) F63S probably damaging Het
Hmcn1 A G 1: 150,494,816 (GRCm39) M4091T probably benign Het
Hspb7 A G 4: 141,149,896 (GRCm39) D94G probably damaging Het
Irf6 T A 1: 192,849,742 (GRCm39) probably null Het
Itgb2 T A 10: 77,381,878 (GRCm39) L60* probably null Het
Jmjd1c C T 10: 66,993,830 (GRCm39) Q104* probably null Het
Kcnh1 A G 1: 191,959,025 (GRCm39) D193G probably damaging Het
Klhl25 G T 7: 75,516,528 (GRCm39) C478F probably damaging Het
Klhl3 T C 13: 58,178,330 (GRCm39) D267G probably damaging Het
L3mbtl4 T G 17: 68,762,708 (GRCm39) H80Q probably null Het
Lhcgr C A 17: 89,049,895 (GRCm39) V544F probably benign Het
Mfsd4a T C 1: 131,985,633 (GRCm39) N168D probably benign Het
Mmp3 A G 9: 7,449,881 (GRCm39) Q255R possibly damaging Het
Mrgprb3 C A 7: 48,293,000 (GRCm39) G184C probably benign Het
Mtpap C T 18: 4,396,394 (GRCm39) A562V possibly damaging Het
Nid1 T C 13: 13,681,086 (GRCm39) V1072A probably benign Het
Nsf T G 11: 103,714,595 (GRCm39) K728T probably damaging Het
Or10ak7 T C 4: 118,791,626 (GRCm39) N140D probably benign Het
Or12j3 T C 7: 139,953,328 (GRCm39) N65S probably damaging Het
Or1e17 T A 11: 73,831,641 (GRCm39) S190T possibly damaging Het
Or2a5 T C 6: 42,874,158 (GRCm39) Y258H probably damaging Het
Or4k15b A T 14: 50,272,821 (GRCm39) V13E probably damaging Het
Pcsk5 A T 19: 17,502,631 (GRCm39) C894S probably damaging Het
Pde2a A G 7: 101,143,879 (GRCm39) D166G probably benign Het
Pfpl G A 19: 12,406,618 (GRCm39) E290K probably benign Het
Pi4kb A C 3: 94,906,162 (GRCm39) I570L probably damaging Het
Plxnb2 A T 15: 89,041,622 (GRCm39) C1727* probably null Het
Poln A T 5: 34,286,792 (GRCm39) D125E possibly damaging Het
Pomgnt1 A G 4: 116,011,412 (GRCm39) D259G possibly damaging Het
Prx A T 7: 27,216,152 (GRCm39) M218L probably benign Het
Pxn A T 5: 115,690,001 (GRCm39) Q342L probably damaging Het
Rhpn2 A G 7: 35,033,775 (GRCm39) D3G possibly damaging Het
Rnase2b C T 14: 51,400,174 (GRCm39) T85I possibly damaging Het
Rnaseh2b C A 14: 62,591,075 (GRCm39) T142K probably damaging Het
Sacs T C 14: 61,450,304 (GRCm39) S4117P probably damaging Het
Sdk2 T C 11: 113,745,195 (GRCm39) N700S probably damaging Het
Sec62 A C 3: 30,864,020 (GRCm39) K101Q unknown Het
Sel1l2 A C 2: 140,071,943 (GRCm39) L659R possibly damaging Het
Septin11 A G 5: 93,304,815 (GRCm39) I211V possibly damaging Het
Slc25a42 C T 8: 70,642,107 (GRCm39) E112K probably damaging Het
Spem2 T C 11: 69,708,609 (GRCm39) N119D probably benign Het
Themis G A 10: 28,665,748 (GRCm39) E604K probably benign Het
Tie1 T C 4: 118,343,414 (GRCm39) K150E probably damaging Het
Top6bl A G 19: 4,675,901 (GRCm39) probably benign Het
Ubap2 G A 4: 41,218,333 (GRCm39) T258I possibly damaging Het
Ushbp1 C T 8: 71,838,313 (GRCm39) A664T probably damaging Het
Vmn1r1 T C 1: 181,984,774 (GRCm39) N297S possibly damaging Het
Vmn1r173 A C 7: 23,402,637 (GRCm39) I291L probably damaging Het
Yy1 A G 12: 108,759,972 (GRCm39) I212V possibly damaging Het
Zfp442 A T 2: 150,250,149 (GRCm39) F527L probably damaging Het
Zyg11b T A 4: 108,099,069 (GRCm39) H632L probably damaging Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACGGGAATTCTTTGGGGC -3'
(R):5'- CTGGTCTTAGATAAACCCCTCC -3'

Sequencing Primer
(F):5'- TCTCTTCAGGTCACACAGTGGG -3'
(R):5'- AGATAAACCCCTCCTTCTTCAC -3'
Posted On 2015-10-21