Incidental Mutation 'R4717:Gsr'
ID354136
Institutional Source Beutler Lab
Gene Symbol Gsr
Ensembl Gene ENSMUSG00000031584
Gene Nameglutathione reductase
SynonymsD8Ertd238e, Gr-1, Gr1
MMRRC Submission 041984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R4717 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location33652523-33698163 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 33693858 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 383 (K383*)
Ref Sequence ENSEMBL: ENSMUSP00000033992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033992]
Predicted Effect probably null
Transcript: ENSMUST00000033992
AA Change: K383*
SMART Domains Protein: ENSMUSP00000033992
Gene: ENSMUSG00000031584
AA Change: K383*

DomainStartEndE-ValueType
low complexity region 17 22 N/A INTRINSIC
Pfam:Pyr_redox_2 43 368 1.2e-73 PFAM
Pfam:Pyr_redox 211 292 1.7e-21 PFAM
Pfam:Pyr_redox_dim 389 500 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158231
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]
PHENOTYPE: A homozygous mutation disrupting this gene between exon 1-2 results in a decreased retinal artery-to-vein ratio. Another small deletion of exons 2-5 has no phenotypic effect. Electrophoretic alleles designated a (C57BL/6, CE) vs. allele b (SJL, SWR) are known. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,221,787 L60P probably damaging Het
Acsf2 T G 11: 94,559,546 M512L probably benign Het
Ahrr T A 13: 74,215,766 H312L probably benign Het
Akr1c18 T C 13: 4,136,718 M244V probably benign Het
Aldh3b2 A G 19: 3,981,128 Y459C probably damaging Het
Arhgap29 A T 3: 122,009,958 I796L possibly damaging Het
Arrdc4 T A 7: 68,741,658 D287V probably damaging Het
Astn2 A T 4: 65,644,754 I930N possibly damaging Het
Bace2 T A 16: 97,436,873 L508Q probably damaging Het
Baz2a G T 10: 128,124,942 C1537F possibly damaging Het
Cad A G 5: 31,066,686 probably null Het
Capn5 A T 7: 98,123,919 I626N probably benign Het
Car8 A T 4: 8,169,685 N274K probably damaging Het
Casp14 T C 10: 78,715,124 I76V probably benign Het
Ccdc88c A G 12: 100,916,666 V1649A probably benign Het
Cemip A T 7: 83,947,280 I1092N probably damaging Het
Clspn A G 4: 126,560,056 N91D probably damaging Het
Cpxm2 A G 7: 132,054,845 Y563H possibly damaging Het
Csnk1g2 T C 10: 80,637,915 V72A probably benign Het
Cyp46a1 T C 12: 108,352,026 probably null Het
Cyp4x1 T C 4: 115,121,705 H206R probably benign Het
Dapk1 T A 13: 60,726,662 probably null Het
Ddx1 A G 12: 13,240,887 W76R probably damaging Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah2 T C 11: 69,429,357 D3962G probably benign Het
Dnajc14 T A 10: 128,806,244 C12S possibly damaging Het
Dock1 T C 7: 134,848,170 I804T probably damaging Het
Efs G T 14: 54,920,344 S170Y probably damaging Het
Eml4 G T 17: 83,448,225 W295C probably benign Het
Fkbp15 A G 4: 62,308,069 S748P probably damaging Het
Ghr T G 15: 3,319,753 I648L possibly damaging Het
Gigyf1 T A 5: 137,525,232 I942N probably damaging Het
Gm960 A G 19: 4,625,873 probably benign Het
Gpam T A 19: 55,075,614 E682D probably benign Het
Hapln1 C A 13: 89,605,460 S248R probably benign Het
Haus2 G T 2: 120,619,102 R209L probably benign Het
Hhatl A G 9: 121,789,877 F63S probably damaging Het
Hmcn1 A G 1: 150,619,065 M4091T probably benign Het
Hspb7 A G 4: 141,422,585 D94G probably damaging Het
Irf6 T A 1: 193,167,434 probably null Het
Itgb2 T A 10: 77,546,044 L60* probably null Het
Jmjd1c C T 10: 67,158,051 Q104* probably null Het
Kcnh1 A G 1: 192,276,717 D193G probably damaging Het
Klhl25 G T 7: 75,866,780 C478F probably damaging Het
Klhl3 T C 13: 58,030,516 D267G probably damaging Het
L3mbtl4 T G 17: 68,455,713 H80Q probably null Het
Lhcgr C A 17: 88,742,467 V544F probably benign Het
Mfsd4a T C 1: 132,057,895 N168D probably benign Het
Mmp3 A G 9: 7,449,881 Q255R possibly damaging Het
Mrgprb3 C A 7: 48,643,252 G184C probably benign Het
Mtpap C T 18: 4,396,394 A562V possibly damaging Het
Nid1 T C 13: 13,506,501 V1072A probably benign Het
Nsf T G 11: 103,823,769 K728T probably damaging Het
Olfr1328 T C 4: 118,934,429 N140D probably benign Het
Olfr23 T A 11: 73,940,815 S190T possibly damaging Het
Olfr448 T C 6: 42,897,224 Y258H probably damaging Het
Olfr530 T C 7: 140,373,415 N65S probably damaging Het
Olfr725 A T 14: 50,035,364 V13E probably damaging Het
Pcsk5 A T 19: 17,525,267 C894S probably damaging Het
Pde2a A G 7: 101,494,672 D166G probably benign Het
Pfpl G A 19: 12,429,254 E290K probably benign Het
Pi4kb A C 3: 94,998,851 I570L probably damaging Het
Plxnb2 A T 15: 89,157,419 C1727* probably null Het
Poln A T 5: 34,129,448 D125E possibly damaging Het
Pomgnt1 A G 4: 116,154,215 D259G possibly damaging Het
Prx A T 7: 27,516,727 M218L probably benign Het
Pxn A T 5: 115,551,942 Q342L probably damaging Het
Rhpn2 A G 7: 35,334,350 D3G possibly damaging Het
Rnase2b C T 14: 51,162,717 T85I possibly damaging Het
Rnaseh2b C A 14: 62,353,626 T142K probably damaging Het
Sacs T C 14: 61,212,855 S4117P probably damaging Het
Sdk2 T C 11: 113,854,369 N700S probably damaging Het
Sec62 A C 3: 30,809,871 K101Q unknown Het
Sel1l2 A C 2: 140,230,023 L659R possibly damaging Het
Sept11 A G 5: 93,156,956 I211V possibly damaging Het
Slc25a42 C T 8: 70,189,457 E112K probably damaging Het
Spem2 T C 11: 69,817,783 N119D probably benign Het
Themis G A 10: 28,789,752 E604K probably benign Het
Tie1 T C 4: 118,486,217 K150E probably damaging Het
Ubap2 G A 4: 41,218,333 T258I possibly damaging Het
Ushbp1 C T 8: 71,385,669 A664T probably damaging Het
Vmn1r1 T C 1: 182,157,209 N297S possibly damaging Het
Vmn1r173 A C 7: 23,703,212 I291L probably damaging Het
Yy1 A G 12: 108,794,046 I212V possibly damaging Het
Zfp442 A T 2: 150,408,229 F527L probably damaging Het
Zyg11b T A 4: 108,241,872 H632L probably damaging Het
Other mutations in Gsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Gsr APN 8 33682584 splice site probably benign
IGL02481:Gsr APN 8 33685541 splice site probably benign
IGL02941:Gsr APN 8 33689425 missense probably damaging 0.98
IGL03242:Gsr APN 8 33685599 missense probably benign
IGL03293:Gsr APN 8 33694996 splice site probably benign
R0208:Gsr UTSW 8 33689355 missense possibly damaging 0.45
R0490:Gsr UTSW 8 33671512 splice site probably benign
R0492:Gsr UTSW 8 33681575 splice site probably benign
R0524:Gsr UTSW 8 33669180 critical splice donor site probably null
R1104:Gsr UTSW 8 33669921 missense probably damaging 1.00
R1976:Gsr UTSW 8 33680260 splice site probably null
R2507:Gsr UTSW 8 33680288 missense probably benign 0.45
R2508:Gsr UTSW 8 33680288 missense probably benign 0.45
R3726:Gsr UTSW 8 33671537 missense probably benign 0.11
R4573:Gsr UTSW 8 33693853 missense probably benign 0.00
R4623:Gsr UTSW 8 33680305 missense probably damaging 0.99
R4639:Gsr UTSW 8 33697256 missense probably damaging 1.00
R4713:Gsr UTSW 8 33680319 critical splice donor site probably null
R4992:Gsr UTSW 8 33693913 missense probably damaging 1.00
R5099:Gsr UTSW 8 33671528 missense probably damaging 1.00
R6019:Gsr UTSW 8 33693807 missense probably damaging 0.97
R7046:Gsr UTSW 8 33695062 missense probably damaging 1.00
R7570:Gsr UTSW 8 33669165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAGCAGTAATGCTAGGTC -3'
(R):5'- ACTGCAGACTAAACAGAGGGTTC -3'

Sequencing Primer
(F):5'- GCAGTAATGCTAGGTCTTCATTATG -3'
(R):5'- GACTAAACAGAGGGTTCCTGTAACTC -3'
Posted On2015-10-21