Mutagenetix > Incidental Mutation

Incidental Mutation 'R4717:Sdk2'

354153

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

041984-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R4717 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113854369 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 700 (N700S)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]

AlphaFold

Q6V4S5

Predicted Effect

probably damaging
Transcript: ENSMUST00000041627
AA Change: N700S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: N700S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141943
AA Change: N700S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: N700S

Domain	Start	End	E-Value	Type
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	889	1.96e1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	T	C	10: 29,221,787	L60P	probably damaging	Het
Acsf2	T	G	11: 94,559,546	M512L	probably benign	Het
Ahrr	T	A	13: 74,215,766	H312L	probably benign	Het
Akr1c18	T	C	13: 4,136,718	M244V	probably benign	Het
Aldh3b2	A	G	19: 3,981,128	Y459C	probably damaging	Het
Arhgap29	A	T	3: 122,009,958	I796L	possibly damaging	Het
Arrdc4	T	A	7: 68,741,658	D287V	probably damaging	Het
Astn2	A	T	4: 65,644,754	I930N	possibly damaging	Het
Bace2	T	A	16: 97,436,873	L508Q	probably damaging	Het
Baz2a	G	T	10: 128,124,942	C1537F	possibly damaging	Het
Cad	A	G	5: 31,066,686		probably null	Het
Capn5	A	T	7: 98,123,919	I626N	probably benign	Het
Car8	A	T	4: 8,169,685	N274K	probably damaging	Het
Casp14	T	C	10: 78,715,124	I76V	probably benign	Het
Ccdc88c	A	G	12: 100,916,666	V1649A	probably benign	Het
Cemip	A	T	7: 83,947,280	I1092N	probably damaging	Het
Clspn	A	G	4: 126,560,056	N91D	probably damaging	Het
Cpxm2	A	G	7: 132,054,845	Y563H	possibly damaging	Het
Csnk1g2	T	C	10: 80,637,915	V72A	probably benign	Het
Cyp46a1	T	C	12: 108,352,026		probably null	Het
Cyp4x1	T	C	4: 115,121,705	H206R	probably benign	Het
Dapk1	T	A	13: 60,726,662		probably null	Het
Ddx1	A	G	12: 13,240,887	W76R	probably damaging	Het
Dhx29	G	A	13: 112,946,935	R508H	unknown	Het
Dnah2	T	C	11: 69,429,357	D3962G	probably benign	Het
Dnajc14	T	A	10: 128,806,244	C12S	possibly damaging	Het
Dock1	T	C	7: 134,848,170	I804T	probably damaging	Het
Efs	G	T	14: 54,920,344	S170Y	probably damaging	Het
Eml4	G	T	17: 83,448,225	W295C	probably benign	Het
Fkbp15	A	G	4: 62,308,069	S748P	probably damaging	Het
Ghr	T	G	15: 3,319,753	I648L	possibly damaging	Het
Gigyf1	T	A	5: 137,525,232	I942N	probably damaging	Het
Gm960	A	G	19: 4,625,873		probably benign	Het
Gpam	T	A	19: 55,075,614	E682D	probably benign	Het
Gsr	A	T	8: 33,693,858	K383*	probably null	Het
Hapln1	C	A	13: 89,605,460	S248R	probably benign	Het
Haus2	G	T	2: 120,619,102	R209L	probably benign	Het
Hhatl	A	G	9: 121,789,877	F63S	probably damaging	Het
Hmcn1	A	G	1: 150,619,065	M4091T	probably benign	Het
Hspb7	A	G	4: 141,422,585	D94G	probably damaging	Het
Irf6	T	A	1: 193,167,434		probably null	Het
Itgb2	T	A	10: 77,546,044	L60*	probably null	Het
Jmjd1c	C	T	10: 67,158,051	Q104*	probably null	Het
Kcnh1	A	G	1: 192,276,717	D193G	probably damaging	Het
Klhl25	G	T	7: 75,866,780	C478F	probably damaging	Het
Klhl3	T	C	13: 58,030,516	D267G	probably damaging	Het
L3mbtl4	T	G	17: 68,455,713	H80Q	probably null	Het
Lhcgr	C	A	17: 88,742,467	V544F	probably benign	Het
Mfsd4a	T	C	1: 132,057,895	N168D	probably benign	Het
Mmp3	A	G	9: 7,449,881	Q255R	possibly damaging	Het
Mrgprb3	C	A	7: 48,643,252	G184C	probably benign	Het
Mtpap	C	T	18: 4,396,394	A562V	possibly damaging	Het
Nid1	T	C	13: 13,506,501	V1072A	probably benign	Het
Nsf	T	G	11: 103,823,769	K728T	probably damaging	Het
Olfr1328	T	C	4: 118,934,429	N140D	probably benign	Het
Olfr23	T	A	11: 73,940,815	S190T	possibly damaging	Het
Olfr448	T	C	6: 42,897,224	Y258H	probably damaging	Het
Olfr530	T	C	7: 140,373,415	N65S	probably damaging	Het
Olfr725	A	T	14: 50,035,364	V13E	probably damaging	Het
Pcsk5	A	T	19: 17,525,267	C894S	probably damaging	Het
Pde2a	A	G	7: 101,494,672	D166G	probably benign	Het
Pfpl	G	A	19: 12,429,254	E290K	probably benign	Het
Pi4kb	A	C	3: 94,998,851	I570L	probably damaging	Het
Plxnb2	A	T	15: 89,157,419	C1727*	probably null	Het
Poln	A	T	5: 34,129,448	D125E	possibly damaging	Het
Pomgnt1	A	G	4: 116,154,215	D259G	possibly damaging	Het
Prx	A	T	7: 27,516,727	M218L	probably benign	Het
Pxn	A	T	5: 115,551,942	Q342L	probably damaging	Het
Rhpn2	A	G	7: 35,334,350	D3G	possibly damaging	Het
Rnase2b	C	T	14: 51,162,717	T85I	possibly damaging	Het
Rnaseh2b	C	A	14: 62,353,626	T142K	probably damaging	Het
Sacs	T	C	14: 61,212,855	S4117P	probably damaging	Het
Sec62	A	C	3: 30,809,871	K101Q	unknown	Het
Sel1l2	A	C	2: 140,230,023	L659R	possibly damaging	Het
Sept11	A	G	5: 93,156,956	I211V	possibly damaging	Het
Slc25a42	C	T	8: 70,189,457	E112K	probably damaging	Het
Spem2	T	C	11: 69,817,783	N119D	probably benign	Het
Themis	G	A	10: 28,789,752	E604K	probably benign	Het
Tie1	T	C	4: 118,486,217	K150E	probably damaging	Het
Ubap2	G	A	4: 41,218,333	T258I	possibly damaging	Het
Ushbp1	C	T	8: 71,385,669	A664T	probably damaging	Het
Vmn1r1	T	C	1: 182,157,209	N297S	possibly damaging	Het
Vmn1r173	A	C	7: 23,703,212	I291L	probably damaging	Het
Yy1	A	G	12: 108,794,046	I212V	possibly damaging	Het
Zfp442	A	T	2: 150,408,229	F527L	probably damaging	Het
Zyg11b	T	A	4: 108,241,872	H632L	probably damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATGTCGGCAAGGATGGACC -3'
(R):5'- TGAAATGAGCTGCCCAGAAAC -3'

Sequencing Primer
(F):5'- ACCTTGAGTCTGTACTGTTCTCTAAG -3'
(R):5'- GCTGCCCAGAAACACAGCG -3'

Posted On

2015-10-21