Incidental Mutation 'R4717:Bace2'
ID 354171
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 041984-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R4717 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 97238073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 508 (L508Q)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047275
AA Change: L508Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: L508Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231892
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,097,783 (GRCm39) L60P probably damaging Het
Acsf2 T G 11: 94,450,372 (GRCm39) M512L probably benign Het
Ahrr T A 13: 74,363,885 (GRCm39) H312L probably benign Het
Akr1c18 T C 13: 4,186,717 (GRCm39) M244V probably benign Het
Aldh3b2 A G 19: 4,031,128 (GRCm39) Y459C probably damaging Het
Arhgap29 A T 3: 121,803,607 (GRCm39) I796L possibly damaging Het
Arrdc4 T A 7: 68,391,406 (GRCm39) D287V probably damaging Het
Astn2 A T 4: 65,562,991 (GRCm39) I930N possibly damaging Het
Baz2a G T 10: 127,960,811 (GRCm39) C1537F possibly damaging Het
Cad A G 5: 31,224,030 (GRCm39) probably null Het
Capn5 A T 7: 97,773,126 (GRCm39) I626N probably benign Het
Car8 A T 4: 8,169,685 (GRCm39) N274K probably damaging Het
Casp14 T C 10: 78,550,958 (GRCm39) I76V probably benign Het
Ccdc88c A G 12: 100,882,925 (GRCm39) V1649A probably benign Het
Cemip A T 7: 83,596,488 (GRCm39) I1092N probably damaging Het
Clspn A G 4: 126,453,849 (GRCm39) N91D probably damaging Het
Cpxm2 A G 7: 131,656,574 (GRCm39) Y563H possibly damaging Het
Csnk1g2 T C 10: 80,473,749 (GRCm39) V72A probably benign Het
Cyp46a1 T C 12: 108,318,285 (GRCm39) probably null Het
Cyp4x1 T C 4: 114,978,902 (GRCm39) H206R probably benign Het
Dapk1 T A 13: 60,874,476 (GRCm39) probably null Het
Ddx1 A G 12: 13,290,888 (GRCm39) W76R probably damaging Het
Dhx29 G A 13: 113,083,469 (GRCm39) R508H unknown Het
Dnah2 T C 11: 69,320,183 (GRCm39) D3962G probably benign Het
Dnajc14 T A 10: 128,642,113 (GRCm39) C12S possibly damaging Het
Dock1 T C 7: 134,449,899 (GRCm39) I804T probably damaging Het
Efs G T 14: 55,157,801 (GRCm39) S170Y probably damaging Het
Eml4 G T 17: 83,755,654 (GRCm39) W295C probably benign Het
Fkbp15 A G 4: 62,226,306 (GRCm39) S748P probably damaging Het
Ghr T G 15: 3,349,235 (GRCm39) I648L possibly damaging Het
Gigyf1 T A 5: 137,523,494 (GRCm39) I942N probably damaging Het
Gpam T A 19: 55,064,046 (GRCm39) E682D probably benign Het
Gsr A T 8: 34,183,886 (GRCm39) K383* probably null Het
Hapln1 C A 13: 89,753,579 (GRCm39) S248R probably benign Het
Haus2 G T 2: 120,449,583 (GRCm39) R209L probably benign Het
Hhatl A G 9: 121,618,943 (GRCm39) F63S probably damaging Het
Hmcn1 A G 1: 150,494,816 (GRCm39) M4091T probably benign Het
Hspb7 A G 4: 141,149,896 (GRCm39) D94G probably damaging Het
Irf6 T A 1: 192,849,742 (GRCm39) probably null Het
Itgb2 T A 10: 77,381,878 (GRCm39) L60* probably null Het
Jmjd1c C T 10: 66,993,830 (GRCm39) Q104* probably null Het
Kcnh1 A G 1: 191,959,025 (GRCm39) D193G probably damaging Het
Klhl25 G T 7: 75,516,528 (GRCm39) C478F probably damaging Het
Klhl3 T C 13: 58,178,330 (GRCm39) D267G probably damaging Het
L3mbtl4 T G 17: 68,762,708 (GRCm39) H80Q probably null Het
Lhcgr C A 17: 89,049,895 (GRCm39) V544F probably benign Het
Mfsd4a T C 1: 131,985,633 (GRCm39) N168D probably benign Het
Mmp3 A G 9: 7,449,881 (GRCm39) Q255R possibly damaging Het
Mrgprb3 C A 7: 48,293,000 (GRCm39) G184C probably benign Het
Mtpap C T 18: 4,396,394 (GRCm39) A562V possibly damaging Het
Nid1 T C 13: 13,681,086 (GRCm39) V1072A probably benign Het
Nsf T G 11: 103,714,595 (GRCm39) K728T probably damaging Het
Or10ak7 T C 4: 118,791,626 (GRCm39) N140D probably benign Het
Or12j3 T C 7: 139,953,328 (GRCm39) N65S probably damaging Het
Or1e17 T A 11: 73,831,641 (GRCm39) S190T possibly damaging Het
Or2a5 T C 6: 42,874,158 (GRCm39) Y258H probably damaging Het
Or4k15b A T 14: 50,272,821 (GRCm39) V13E probably damaging Het
Pcsk5 A T 19: 17,502,631 (GRCm39) C894S probably damaging Het
Pde2a A G 7: 101,143,879 (GRCm39) D166G probably benign Het
Pfpl G A 19: 12,406,618 (GRCm39) E290K probably benign Het
Pi4kb A C 3: 94,906,162 (GRCm39) I570L probably damaging Het
Plxnb2 A T 15: 89,041,622 (GRCm39) C1727* probably null Het
Poln A T 5: 34,286,792 (GRCm39) D125E possibly damaging Het
Pomgnt1 A G 4: 116,011,412 (GRCm39) D259G possibly damaging Het
Prx A T 7: 27,216,152 (GRCm39) M218L probably benign Het
Pxn A T 5: 115,690,001 (GRCm39) Q342L probably damaging Het
Rhpn2 A G 7: 35,033,775 (GRCm39) D3G possibly damaging Het
Rnase2b C T 14: 51,400,174 (GRCm39) T85I possibly damaging Het
Rnaseh2b C A 14: 62,591,075 (GRCm39) T142K probably damaging Het
Sacs T C 14: 61,450,304 (GRCm39) S4117P probably damaging Het
Sdk2 T C 11: 113,745,195 (GRCm39) N700S probably damaging Het
Sec62 A C 3: 30,864,020 (GRCm39) K101Q unknown Het
Sel1l2 A C 2: 140,071,943 (GRCm39) L659R possibly damaging Het
Septin11 A G 5: 93,304,815 (GRCm39) I211V possibly damaging Het
Slc25a42 C T 8: 70,642,107 (GRCm39) E112K probably damaging Het
Spem2 T C 11: 69,708,609 (GRCm39) N119D probably benign Het
Themis G A 10: 28,665,748 (GRCm39) E604K probably benign Het
Tie1 T C 4: 118,343,414 (GRCm39) K150E probably damaging Het
Top6bl A G 19: 4,675,901 (GRCm39) probably benign Het
Ubap2 G A 4: 41,218,333 (GRCm39) T258I possibly damaging Het
Ushbp1 C T 8: 71,838,313 (GRCm39) A664T probably damaging Het
Vmn1r1 T C 1: 181,984,774 (GRCm39) N297S possibly damaging Het
Vmn1r173 A C 7: 23,402,637 (GRCm39) I291L probably damaging Het
Yy1 A G 12: 108,759,972 (GRCm39) I212V possibly damaging Het
Zfp442 A T 2: 150,250,149 (GRCm39) F527L probably damaging Het
Zyg11b T A 4: 108,099,069 (GRCm39) H632L probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAACTGTGTTCCAGCAC -3'
(R):5'- CCAATGCACTGTTTTGGTTCAC -3'

Sequencing Primer
(F):5'- ATGCCCTGATGAGTGTGT -3'
(R):5'- ATGCACTGTTTTGGTTCACAATGAG -3'
Posted On 2015-10-21