Incidental Mutation 'R0276:Baiap3'
ID 35423
Institutional Source Beutler Lab
Gene Symbol Baiap3
Ensembl Gene ENSMUSG00000047507
Gene Name BAI1-associated protein 3
Synonyms LOC381076
MMRRC Submission 038498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0276 (G1)
Quality Score 188
Status Validated
Chromosome 17
Chromosomal Location 25242659-25256364 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 25243687 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 1099 (F1099C)
Ref Sequence ENSEMBL: ENSMUSP00000138254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038973] [ENSMUST00000063574] [ENSMUST00000115154] [ENSMUST00000169109] [ENSMUST00000182056] [ENSMUST00000182435] [ENSMUST00000182825]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000038973
SMART Domains Protein: ENSMUSP00000042073
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 152 1.4e-10 PFAM
DMAP_binding 176 278 2.55e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063574
SMART Domains Protein: ENSMUSP00000068511
Gene: ENSMUSG00000015126

DomainStartEndE-ValueType
Pfam:RLI 58 92 8.2e-17 PFAM
Pfam:DUF367 96 222 1.3e-56 PFAM
low complexity region 261 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115154
SMART Domains Protein: ENSMUSP00000110807
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 151 3.9e-11 PFAM
DMAP_binding 183 285 2.55e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169109
AA Change: F1112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129854
Gene: ENSMUSG00000047507
AA Change: F1112C

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
Pfam:Membr_traf_MHD 896 958 8e-10 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175461
Predicted Effect probably damaging
Transcript: ENSMUST00000182056
AA Change: F1135C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138188
Gene: ENSMUSG00000047507
AA Change: F1135C

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Pfam:Membr_traf_MHD 851 959 3.3e-30 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182126
Predicted Effect probably damaging
Transcript: ENSMUST00000182435
AA Change: F1107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138796
Gene: ENSMUSG00000047507
AA Change: F1107C

DomainStartEndE-ValueType
C2 131 300 4.73e-17 SMART
low complexity region 333 351 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Membr_traf_MHD 823 931 3.2e-30 PFAM
C2 961 1069 7.06e-16 SMART
Predicted Effect silent
Transcript: ENSMUST00000182696
Predicted Effect probably damaging
Transcript: ENSMUST00000182825
AA Change: F1099C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138254
Gene: ENSMUSG00000047507
AA Change: F1099C

DomainStartEndE-ValueType
C2 159 284 4.05e-16 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 461 473 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
Pfam:Membr_traf_MHD 815 923 3.2e-30 PFAM
C2 953 1061 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182922
Meta Mutation Damage Score 0.3794 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but exhibit increased PTZ-induced seizure propensity, as well as increased novelty-induced anxiety in both genders, with a more pronounced effect in females, and a faster developmentof tolerance to benzodiazepines in male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,975,760 N109S possibly damaging Het
Adcy10 T A 1: 165,572,591 M1523K possibly damaging Het
Agtpbp1 C T 13: 59,462,031 S1095N possibly damaging Het
Ang2 C T 14: 51,195,518 V136I probably damaging Het
Arhgap10 A T 8: 77,413,581 M250K probably benign Het
Arhgap33 A T 7: 30,523,244 W1088R probably benign Het
Arhgef15 T C 11: 68,953,472 probably benign Het
Aspm T C 1: 139,478,471 S1699P possibly damaging Het
Atp12a C A 14: 56,387,694 D1014E probably damaging Het
Atp1a4 T A 1: 172,257,901 K45M probably damaging Het
Atp8a1 A T 5: 67,786,673 probably benign Het
Bcas3 T A 11: 85,470,837 probably null Het
Bms1 G A 6: 118,408,134 T371M possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Capn3 T C 2: 120,488,065 probably benign Het
Ccdc180 A G 4: 45,923,534 D1105G probably damaging Het
Ccdc33 G T 9: 58,058,392 P364Q probably damaging Het
Ccdc36 A T 9: 108,428,440 M11K possibly damaging Het
Clstn3 A G 6: 124,431,740 probably benign Het
Cntrl A T 2: 35,151,732 Y619F possibly damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Cpt1b T C 15: 89,419,959 H503R probably benign Het
Crb1 T A 1: 139,323,335 T293S possibly damaging Het
D130043K22Rik C T 13: 24,858,045 T319I possibly damaging Het
Dzip1l G A 9: 99,660,998 R502Q probably benign Het
Efcab5 A G 11: 77,129,876 M673T probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
F2rl3 A G 8: 72,762,798 T218A probably benign Het
Fam135a C T 1: 24,067,964 R31H probably damaging Het
Fam84b G T 15: 60,823,674 Y74* probably null Het
Fcer2a A T 8: 3,689,811 N53K possibly damaging Het
Gm14085 T A 2: 122,521,928 S389T probably damaging Het
Golgb1 A C 16: 36,913,876 K1162Q probably damaging Het
Gpr137b A T 13: 13,367,575 probably benign Het
Haspin A T 11: 73,136,487 L592Q probably damaging Het
Helq A G 5: 100,790,147 F478L probably damaging Het
Il17rb T A 14: 30,004,380 T84S probably damaging Het
Itga4 T C 2: 79,321,493 L880P probably damaging Het
Itih5 A G 2: 10,185,564 I61V possibly damaging Het
Ivl G A 3: 92,571,514 L415F unknown Het
Kif2a A G 13: 106,976,650 probably benign Het
Kmt2d T C 15: 98,850,311 probably benign Het
Lars2 A G 9: 123,438,121 probably benign Het
Lilrb4a T C 10: 51,491,581 V73A probably benign Het
Lrrc8a A G 2: 30,256,788 D538G possibly damaging Het
Lrrk1 G A 7: 66,296,263 probably benign Het
Mc2r A T 18: 68,408,132 I30K possibly damaging Het
Mybbp1a C A 11: 72,450,107 probably null Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ncam2 A G 16: 81,517,629 probably benign Het
Nlk T C 11: 78,571,475 I509V probably benign Het
Nlrp2 A T 7: 5,328,109 N429K probably benign Het
Nlrp9b A G 7: 20,028,498 T247A probably benign Het
Noxo1 A T 17: 24,700,162 probably null Het
Olfr1212 T A 2: 88,958,755 C96* probably null Het
Olfr139 A G 11: 74,045,118 I52T probably damaging Het
Olfr353 A T 2: 36,890,023 M275K probably benign Het
Olfr701 A T 7: 106,818,697 I205L probably benign Het
Olfr734 C A 14: 50,320,179 A219S probably benign Het
Oxr1 T C 15: 41,820,062 S294P probably damaging Het
Pfpl A G 19: 12,429,237 Y284C probably damaging Het
Pi16 A T 17: 29,326,943 T232S probably benign Het
Plcxd2 A T 16: 46,009,707 N50K probably benign Het
Plekhn1 T A 4: 156,228,246 N52Y probably damaging Het
Prl2c5 T C 13: 13,183,049 probably benign Het
Prrc2b G A 2: 32,219,654 V1080I probably damaging Het
Psg28 A T 7: 18,430,396 N130K probably benign Het
Psme4 C A 11: 30,811,980 T440K probably damaging Het
Ptcd2 T C 13: 99,321,596 K296E probably benign Het
Ptprq T C 10: 107,542,735 probably null Het
Rab5b A C 10: 128,686,746 probably null Het
Rft1 T A 14: 30,690,583 S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rsu1 A T 2: 13,170,135 probably benign Het
Senp6 A G 9: 80,136,747 M887V probably benign Het
Sgcz T A 8: 37,952,919 M60L probably benign Het
Siglec1 G A 2: 131,083,941 Q282* probably null Het
Sipa1l2 T C 8: 125,421,940 T1655A probably damaging Het
Slc43a3 G A 2: 84,937,663 probably benign Het
Snx29 T C 16: 11,738,373 V756A probably benign Het
Spta1 T A 1: 174,217,894 H1539Q probably damaging Het
Stk3 A C 15: 35,099,469 S104A probably damaging Het
Stk38 C A 17: 28,992,416 probably null Het
Stx6 T C 1: 155,174,163 probably benign Het
Thbs4 G A 13: 92,775,532 T230I probably benign Het
Thrsp A G 7: 97,417,502 M1T probably null Het
Tmem63b A T 17: 45,675,373 probably benign Het
Top2a A G 11: 99,009,907 probably benign Het
Tpd52l2 T C 2: 181,502,059 probably null Het
Trak1 A G 9: 121,454,338 E390G probably damaging Het
Trappc3 T A 4: 126,273,952 D101E possibly damaging Het
Trhr A G 15: 44,197,086 M1V probably null Het
Triobp T A 15: 78,973,676 I1159K probably benign Het
Unc45a A G 7: 80,326,297 probably benign Het
Usb1 A G 8: 95,333,457 D12G probably damaging Het
Ushbp1 C T 8: 71,394,649 C113Y possibly damaging Het
Vim A G 2: 13,574,859 K143R probably benign Het
Vmn2r75 T C 7: 86,148,307 K766R probably benign Het
Wdr92 T C 11: 17,229,821 I274T probably benign Het
Xpo5 T G 17: 46,241,507 C1089G probably damaging Het
Other mutations in Baiap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Baiap3 APN 17 25244328 missense probably damaging 1.00
IGL00486:Baiap3 APN 17 25248377 splice site probably benign
IGL00820:Baiap3 APN 17 25248690 missense probably benign 0.20
IGL01443:Baiap3 APN 17 25245147 missense possibly damaging 0.92
IGL02282:Baiap3 APN 17 25249377 missense probably benign 0.11
IGL02341:Baiap3 APN 17 25248316 missense possibly damaging 0.52
IGL02669:Baiap3 APN 17 25244348 missense probably damaging 1.00
IGL02863:Baiap3 APN 17 25244502 splice site probably benign
IGL02993:Baiap3 APN 17 25250082 critical splice donor site probably null
R0021:Baiap3 UTSW 17 25243669 missense probably damaging 1.00
R0090:Baiap3 UTSW 17 25250070 splice site probably benign
R0488:Baiap3 UTSW 17 25248470 critical splice donor site probably null
R0826:Baiap3 UTSW 17 25245229 missense possibly damaging 0.89
R0883:Baiap3 UTSW 17 25249101 missense probably damaging 1.00
R1700:Baiap3 UTSW 17 25249328 missense probably damaging 1.00
R1702:Baiap3 UTSW 17 25244805 missense probably damaging 1.00
R2336:Baiap3 UTSW 17 25250404 missense probably damaging 1.00
R2762:Baiap3 UTSW 17 25244575 missense probably damaging 1.00
R4454:Baiap3 UTSW 17 25249536 missense probably damaging 1.00
R4540:Baiap3 UTSW 17 25246670 missense probably damaging 1.00
R4609:Baiap3 UTSW 17 25250261 missense probably damaging 1.00
R4816:Baiap3 UTSW 17 25247295 splice site probably benign
R4979:Baiap3 UTSW 17 25246362 missense possibly damaging 0.57
R5069:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5070:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5093:Baiap3 UTSW 17 25250269 missense probably damaging 1.00
R5130:Baiap3 UTSW 17 25245342 missense probably benign 0.01
R5566:Baiap3 UTSW 17 25251733 missense probably damaging 1.00
R5572:Baiap3 UTSW 17 25251475 missense possibly damaging 0.86
R5681:Baiap3 UTSW 17 25249373 missense probably damaging 1.00
R5730:Baiap3 UTSW 17 25247524 missense probably benign 0.01
R5743:Baiap3 UTSW 17 25244785 missense probably benign 0.02
R5805:Baiap3 UTSW 17 25247515 missense probably benign 0.12
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6052:Baiap3 UTSW 17 25248470 critical splice donor site probably benign
R6238:Baiap3 UTSW 17 25245758 missense probably benign 0.00
R6700:Baiap3 UTSW 17 25244026 missense probably damaging 1.00
R7037:Baiap3 UTSW 17 25243840 missense probably benign
R7038:Baiap3 UTSW 17 25243840 missense probably benign
R7039:Baiap3 UTSW 17 25243840 missense probably benign
R7126:Baiap3 UTSW 17 25245145 missense possibly damaging 0.64
R7198:Baiap3 UTSW 17 25243840 missense probably benign
R7223:Baiap3 UTSW 17 25243840 missense probably benign
R7291:Baiap3 UTSW 17 25244317 missense probably damaging 1.00
R7438:Baiap3 UTSW 17 25249108 missense possibly damaging 0.91
R7687:Baiap3 UTSW 17 25249337 missense possibly damaging 0.88
R7877:Baiap3 UTSW 17 25251138 missense probably damaging 0.99
R8172:Baiap3 UTSW 17 25244122 missense probably damaging 1.00
R8184:Baiap3 UTSW 17 25248525 missense probably benign 0.00
R8230:Baiap3 UTSW 17 25246853 missense probably benign 0.00
R8240:Baiap3 UTSW 17 25245314 critical splice donor site probably null
R8394:Baiap3 UTSW 17 25250122 missense probably benign
R8972:Baiap3 UTSW 17 25247036 missense probably benign 0.04
R9274:Baiap3 UTSW 17 25244380 missense probably damaging 0.96
R9333:Baiap3 UTSW 17 25248702 missense possibly damaging 0.54
R9388:Baiap3 UTSW 17 25247135 critical splice donor site probably null
X0017:Baiap3 UTSW 17 25248350 missense possibly damaging 0.92
Z1176:Baiap3 UTSW 17 25244768 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTCCTGAGAGCATATGACCACTGC -3'
(R):5'- GGCTGTCCACCAATGACTTTGCTG -3'

Sequencing Primer
(F):5'- AGCATATGACCACTGCTCTGG -3'
(R):5'- CATCAGTGGCATCGCAAG -3'
Posted On 2013-05-09