Incidental Mutation 'R4719:Cdh20'
ID 354269
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Name cadherin 20
Synonyms Cdh7
MMRRC Submission 041957-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R4719 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 104696254-104923206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104862035 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 72 (Y72H)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
AlphaFold Q9Z0M3
Predicted Effect probably damaging
Transcript: ENSMUST00000062528
AA Change: Y72H

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: Y72H

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Meta Mutation Damage Score 0.1743 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,089,971 (GRCm39) Y971C probably damaging Het
Actr5 T A 2: 158,468,433 (GRCm39) S188T probably damaging Het
Adamtsl4 A G 3: 95,586,896 (GRCm39) probably null Het
Agbl2 A G 2: 90,645,733 (GRCm39) N822S probably benign Het
Ankdd1b T A 13: 96,554,255 (GRCm39) probably benign Het
Arhgef40 C T 14: 52,242,395 (GRCm39) probably benign Het
Art5 A G 7: 101,747,701 (GRCm39) probably null Het
Atpsckmt T G 15: 31,608,243 (GRCm39) V98G probably damaging Het
Cacna1s T C 1: 136,046,390 (GRCm39) probably benign Het
Car9 G A 4: 43,508,616 (GRCm39) W42* probably null Het
Ces1g T C 8: 94,043,718 (GRCm39) D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 (GRCm39) D73E probably benign Het
Col6a4 A T 9: 105,945,451 (GRCm39) F888I probably damaging Het
Dgat2 T C 7: 98,807,504 (GRCm39) D222G probably benign Het
Dscaml1 T C 9: 45,583,993 (GRCm39) M486T probably benign Het
Faim2 C T 15: 99,425,460 (GRCm39) probably null Het
Fance T C 17: 28,537,293 (GRCm39) probably benign Het
Fancm G T 12: 65,168,480 (GRCm39) M1614I possibly damaging Het
Fcrl5 A T 3: 87,351,496 (GRCm39) N248I probably damaging Het
Foxo3 G A 10: 42,073,774 (GRCm39) R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 (GRCm39) Y74H probably damaging Het
Gatd1 A C 7: 140,990,981 (GRCm39) D55E probably benign Het
Gpr152 C A 19: 4,193,223 (GRCm39) Q255K possibly damaging Het
Havcr1 A G 11: 46,643,268 (GRCm39) T63A probably benign Het
Hltf T C 3: 20,118,865 (GRCm39) probably null Het
Ifit3b A T 19: 34,590,030 (GRCm39) Q402L probably damaging Het
Ints3 A G 3: 90,322,828 (GRCm39) L134S probably benign Het
Kcna10 A G 3: 107,102,217 (GRCm39) T283A probably benign Het
Kmt2e A C 5: 23,697,313 (GRCm39) R590S probably damaging Het
Lefty1 A T 1: 180,765,277 (GRCm39) N282Y probably benign Het
Loxl4 T A 19: 42,596,030 (GRCm39) Y141F probably benign Het
Lrrn2 T C 1: 132,866,915 (GRCm39) V660A probably benign Het
Lyst T C 13: 13,824,935 (GRCm39) S1517P probably benign Het
Mcoln2 A G 3: 145,881,468 (GRCm39) H208R probably benign Het
Mdga2 C T 12: 66,517,775 (GRCm39) probably benign Het
Mpp2 T A 11: 101,955,259 (GRCm39) E122V possibly damaging Het
Mrgprb5 T C 7: 47,818,526 (GRCm39) N70D probably damaging Het
Muc5ac A T 7: 141,343,500 (GRCm39) E37D possibly damaging Het
Nbeal1 T A 1: 60,274,722 (GRCm39) probably null Het
Ncoa6 T C 2: 155,233,081 (GRCm39) probably benign Het
Nfib C A 4: 82,422,967 (GRCm39) probably null Het
Nostrin G T 2: 68,975,156 (GRCm39) G24* probably null Het
Nudc A G 4: 133,260,576 (GRCm39) Y293H probably damaging Het
Or51a42 T A 7: 103,707,940 (GRCm39) N290Y probably damaging Het
Pcmtd1 T A 1: 7,225,325 (GRCm39) Y41* probably null Het
Pigt T C 2: 164,343,544 (GRCm39) L340P probably damaging Het
Pomgnt1 T C 4: 116,012,972 (GRCm39) Y420H probably damaging Het
Pramel6 C T 2: 87,341,096 (GRCm39) T476I probably benign Het
Ptprn2 T A 12: 116,788,016 (GRCm39) H118Q possibly damaging Het
Rasl10a G A 11: 5,008,517 (GRCm39) S71N probably benign Het
Rnf213 A G 11: 119,310,893 (GRCm39) I804V probably benign Het
Rps4l-ps T C 7: 114,526,537 (GRCm39) noncoding transcript Het
Sash1 T A 10: 8,605,477 (GRCm39) H971L probably benign Het
Secisbp2 T A 13: 51,806,768 (GRCm39) F54L possibly damaging Het
Senp1 A T 15: 97,954,731 (GRCm39) H484Q probably benign Het
Slc12a1 T C 2: 124,995,913 (GRCm39) I22T possibly damaging Het
Slc25a36 A G 9: 96,972,172 (GRCm39) probably benign Het
Srcap T A 7: 127,140,731 (GRCm39) S1443T probably benign Het
Sv2c T C 13: 96,123,319 (GRCm39) T385A probably benign Het
Tas2r131 T A 6: 132,933,936 (GRCm39) H291L probably damaging Het
Thbs3 A G 3: 89,124,147 (GRCm39) D80G probably damaging Het
Tnxb C T 17: 34,908,394 (GRCm39) S1349L probably damaging Het
Toporsl A G 4: 52,611,996 (GRCm39) R630G probably benign Het
Vmn1r43 C A 6: 89,846,837 (GRCm39) M216I probably benign Het
Wdr17 T A 8: 55,092,911 (GRCm39) E1068D probably benign Het
Wnt10a G A 1: 74,842,762 (GRCm39) V413I probably damaging Het
Zfp141 T C 7: 42,126,111 (GRCm39) probably null Het
Zfp169 T C 13: 48,643,634 (GRCm39) I498V probably benign Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104,881,612 (GRCm39) missense probably benign 0.05
IGL00742:Cdh20 APN 1 109,993,356 (GRCm39) missense probably benign 0.22
IGL00743:Cdh20 APN 1 104,875,153 (GRCm39) missense probably benign 0.06
IGL00848:Cdh20 APN 1 104,861,981 (GRCm39) missense probably benign
IGL00861:Cdh20 APN 1 109,988,718 (GRCm39) splice site probably benign
IGL01016:Cdh20 APN 1 110,036,686 (GRCm39) critical splice donor site probably null
IGL01393:Cdh20 APN 1 104,861,969 (GRCm39) missense probably benign
IGL01396:Cdh20 APN 1 104,875,154 (GRCm39) missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104,861,832 (GRCm39) missense probably benign 0.05
IGL01538:Cdh20 APN 1 109,988,870 (GRCm39) missense probably damaging 1.00
IGL01612:Cdh20 APN 1 104,921,895 (GRCm39) missense probably benign 0.02
IGL01763:Cdh20 APN 1 109,993,520 (GRCm39) missense probably benign 0.00
IGL01765:Cdh20 APN 1 109,988,836 (GRCm39) missense probably damaging 1.00
IGL01937:Cdh20 APN 1 110,065,826 (GRCm39) missense probably benign
IGL01947:Cdh20 APN 1 104,921,649 (GRCm39) missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104,868,762 (GRCm39) missense probably damaging 1.00
IGL02020:Cdh20 APN 1 110,066,078 (GRCm39) missense probably damaging 1.00
IGL02135:Cdh20 APN 1 110,066,004 (GRCm39) nonsense probably null
IGL02226:Cdh20 APN 1 104,881,816 (GRCm39) splice site probably benign
IGL02285:Cdh20 APN 1 110,065,921 (GRCm39) missense probably damaging 1.00
IGL02318:Cdh20 APN 1 104,881,764 (GRCm39) missense probably null 0.03
IGL02326:Cdh20 APN 1 104,902,764 (GRCm39) missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104,875,190 (GRCm39) missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104,861,823 (GRCm39) start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104,868,982 (GRCm39) missense probably damaging 1.00
IGL03237:Cdh20 APN 1 110,066,037 (GRCm39) missense possibly damaging 0.89
IGL03280:Cdh20 APN 1 110,036,498 (GRCm39) nonsense probably null
IGL03347:Cdh20 APN 1 110,065,973 (GRCm39) missense possibly damaging 0.53
IGL03385:Cdh20 APN 1 109,993,516 (GRCm39) missense possibly damaging 0.90
3-1:Cdh20 UTSW 1 104,875,145 (GRCm39) missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
BB012:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
IGL02802:Cdh20 UTSW 1 110,065,655 (GRCm39) missense probably damaging 1.00
IGL02991:Cdh20 UTSW 1 104,861,972 (GRCm39) missense probably benign
R0030:Cdh20 UTSW 1 110,065,798 (GRCm39) nonsense probably null
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0178:Cdh20 UTSW 1 104,902,776 (GRCm39) missense possibly damaging 0.82
R0255:Cdh20 UTSW 1 109,922,036 (GRCm39) missense probably benign 0.09
R0365:Cdh20 UTSW 1 110,036,486 (GRCm39) missense probably damaging 1.00
R0506:Cdh20 UTSW 1 110,027,844 (GRCm39) missense probably damaging 1.00
R0549:Cdh20 UTSW 1 110,036,674 (GRCm39) missense probably damaging 1.00
R0599:Cdh20 UTSW 1 109,980,696 (GRCm39) missense probably damaging 1.00
R0648:Cdh20 UTSW 1 109,993,337 (GRCm39) splice site probably benign
R1033:Cdh20 UTSW 1 110,012,783 (GRCm39) missense probably damaging 0.96
R1114:Cdh20 UTSW 1 104,906,739 (GRCm39) missense probably damaging 0.96
R1173:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1174:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1175:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1401:Cdh20 UTSW 1 104,875,222 (GRCm39) missense possibly damaging 0.65
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1502:Cdh20 UTSW 1 104,881,755 (GRCm39) missense probably benign 0.06
R1587:Cdh20 UTSW 1 110,027,757 (GRCm39) missense probably damaging 0.98
R1728:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1729:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1730:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1739:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1762:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1764:Cdh20 UTSW 1 104,862,070 (GRCm39) splice site probably benign
R1769:Cdh20 UTSW 1 109,980,606 (GRCm39) missense probably damaging 1.00
R1783:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1785:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1940:Cdh20 UTSW 1 109,976,754 (GRCm39) missense probably benign 0.09
R1972:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1973:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1997:Cdh20 UTSW 1 109,976,668 (GRCm39) missense probably damaging 1.00
R2060:Cdh20 UTSW 1 109,976,607 (GRCm39) missense probably damaging 1.00
R2068:Cdh20 UTSW 1 110,065,666 (GRCm39) nonsense probably null
R2069:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R2137:Cdh20 UTSW 1 110,027,836 (GRCm39) missense probably damaging 0.97
R2155:Cdh20 UTSW 1 109,976,594 (GRCm39) missense probably damaging 1.00
R2198:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104,875,139 (GRCm39) missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104,902,740 (GRCm39) missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104,875,199 (GRCm39) missense probably damaging 1.00
R3780:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3781:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3782:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R4115:Cdh20 UTSW 1 110,066,039 (GRCm39) missense probably benign 0.37
R4243:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4277:Cdh20 UTSW 1 109,993,418 (GRCm39) missense probably benign 0.00
R4299:Cdh20 UTSW 1 109,988,731 (GRCm39) missense probably damaging 0.99
R4349:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4754:Cdh20 UTSW 1 104,912,410 (GRCm39) missense probably damaging 0.99
R4777:Cdh20 UTSW 1 109,922,055 (GRCm39) nonsense probably null
R4795:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4907:Cdh20 UTSW 1 110,066,053 (GRCm39) missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104,912,528 (GRCm39) missense probably damaging 1.00
R5045:Cdh20 UTSW 1 110,026,080 (GRCm39) missense probably benign 0.01
R5056:Cdh20 UTSW 1 104,881,722 (GRCm39) missense probably benign 0.00
R5059:Cdh20 UTSW 1 109,993,430 (GRCm39) missense probably damaging 0.98
R5127:Cdh20 UTSW 1 104,875,073 (GRCm39) missense probably damaging 1.00
R5146:Cdh20 UTSW 1 109,922,042 (GRCm39) missense probably damaging 0.97
R5196:Cdh20 UTSW 1 110,065,730 (GRCm39) missense probably damaging 0.99
R5269:Cdh20 UTSW 1 104,861,882 (GRCm39) missense possibly damaging 0.67
R5304:Cdh20 UTSW 1 110,036,569 (GRCm39) missense probably damaging 1.00
R5496:Cdh20 UTSW 1 109,976,647 (GRCm39) missense probably damaging 1.00
R5563:Cdh20 UTSW 1 104,875,082 (GRCm39) missense probably benign 0.29
R5634:Cdh20 UTSW 1 104,902,800 (GRCm39) missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104,912,635 (GRCm39) missense probably damaging 1.00
R5743:Cdh20 UTSW 1 110,036,575 (GRCm39) missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104,861,823 (GRCm39) start codon destroyed probably null 0.49
R5867:Cdh20 UTSW 1 109,976,581 (GRCm39) missense probably damaging 1.00
R5933:Cdh20 UTSW 1 104,912,396 (GRCm39) missense probably damaging 1.00
R6042:Cdh20 UTSW 1 110,065,997 (GRCm39) missense probably damaging 0.97
R6092:Cdh20 UTSW 1 110,026,036 (GRCm39) missense probably benign 0.00
R6109:Cdh20 UTSW 1 104,921,739 (GRCm39) missense probably damaging 1.00
R6497:Cdh20 UTSW 1 109,993,528 (GRCm39) critical splice donor site probably null
R6521:Cdh20 UTSW 1 104,869,859 (GRCm39) missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104,912,411 (GRCm39) missense possibly damaging 0.95
R7111:Cdh20 UTSW 1 110,065,638 (GRCm39) missense
R7169:Cdh20 UTSW 1 104,875,078 (GRCm39) missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104,921,702 (GRCm39) missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104,881,796 (GRCm39) missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104,898,598 (GRCm39) missense probably benign
R7511:Cdh20 UTSW 1 109,925,583 (GRCm39) intron probably benign
R7532:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R7535:Cdh20 UTSW 1 104,902,768 (GRCm39) missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104,869,004 (GRCm39) missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104,869,024 (GRCm39) missense probably damaging 1.00
R7879:Cdh20 UTSW 1 109,976,677 (GRCm39) missense probably benign 0.01
R7879:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R7915:Cdh20 UTSW 1 104,861,898 (GRCm39) missense probably benign 0.15
R7925:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
R7978:Cdh20 UTSW 1 109,921,835 (GRCm39) start gained probably benign
R8022:Cdh20 UTSW 1 109,988,838 (GRCm39) missense probably benign 0.02
R8207:Cdh20 UTSW 1 109,922,076 (GRCm39) missense probably damaging 1.00
R8224:Cdh20 UTSW 1 109,921,933 (GRCm39) missense probably benign
R8239:Cdh20 UTSW 1 110,027,832 (GRCm39) missense probably benign 0.11
R8257:Cdh20 UTSW 1 104,921,962 (GRCm39) missense probably benign 0.25
R8444:Cdh20 UTSW 1 104,898,583 (GRCm39) missense probably benign 0.16
R8546:Cdh20 UTSW 1 104,861,769 (GRCm39) start gained probably benign
R8749:Cdh20 UTSW 1 110,027,009 (GRCm39) missense probably damaging 1.00
R8870:Cdh20 UTSW 1 104,873,048 (GRCm39) missense probably damaging 0.99
R8884:Cdh20 UTSW 1 110,027,860 (GRCm39) missense probably damaging 1.00
R9030:Cdh20 UTSW 1 110,027,843 (GRCm39) missense probably benign 0.21
R9310:Cdh20 UTSW 1 104,875,061 (GRCm39) missense probably damaging 1.00
R9498:Cdh20 UTSW 1 109,976,635 (GRCm39) missense probably benign 0.03
R9542:Cdh20 UTSW 1 104,875,067 (GRCm39) missense probably damaging 1.00
R9602:Cdh20 UTSW 1 104,868,823 (GRCm39) missense probably benign 0.07
R9658:Cdh20 UTSW 1 109,988,785 (GRCm39) missense probably damaging 0.99
R9664:Cdh20 UTSW 1 104,862,065 (GRCm39) missense probably benign 0.10
Z1088:Cdh20 UTSW 1 110,012,853 (GRCm39) missense probably benign 0.01
Z1176:Cdh20 UTSW 1 110,036,466 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACTCCTGCAAGCCCATG -3'
(R):5'- TGGTGGTCAGTAATGTCCAACTAG -3'

Sequencing Primer
(F):5'- TGCAAGCCCATGTGGACTAC -3'
(R):5'- GGTCAGTAATGTCCAACTAGTTAAC -3'
Posted On 2015-10-21