Incidental Mutation 'R4719:Abcb11'
ID354274
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 041957-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R4719 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69259627 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 971 (Y971C)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: Y971C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: Y971C

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: Y971C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: Y971C

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126240
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: Y971C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: Y971C

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 T A 2: 158,626,513 S188T probably damaging Het
Adamtsl4 A G 3: 95,679,586 probably null Het
Agbl2 A G 2: 90,815,389 N822S probably benign Het
Ankdd1b T A 13: 96,417,747 probably benign Het
Arhgef40 C T 14: 52,004,938 probably benign Het
Art5 A G 7: 102,098,494 probably null Het
Cacna1s T C 1: 136,118,652 probably benign Het
Car9 G A 4: 43,508,616 W42* probably null Het
Cdh20 T C 1: 104,934,310 Y72H probably damaging Het
Ces1g T C 8: 93,317,090 D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 D73E probably benign Het
Col6a4 A T 9: 106,068,252 F888I probably damaging Het
Dgat2 T C 7: 99,158,297 D222G probably benign Het
Dscaml1 T C 9: 45,672,695 M486T probably benign Het
Faim2 C T 15: 99,527,579 probably null Het
Fam173b T G 15: 31,608,097 V98G probably damaging Het
Fance T C 17: 28,318,319 probably benign Het
Fancm G T 12: 65,121,706 M1614I possibly damaging Het
Fcrl5 A T 3: 87,444,189 N248I probably damaging Het
Foxo3 G A 10: 42,197,778 R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 Y74H probably damaging Het
Gatd1 A C 7: 141,411,068 D55E probably benign Het
Gpr152 C A 19: 4,143,224 Q255K possibly damaging Het
Havcr1 A G 11: 46,752,441 T63A probably benign Het
Hltf T C 3: 20,064,701 probably null Het
Ifit3b A T 19: 34,612,630 Q402L probably damaging Het
Ints3 A G 3: 90,415,521 L134S probably benign Het
Kcna10 A G 3: 107,194,901 T283A probably benign Het
Kmt2e A C 5: 23,492,315 R590S probably damaging Het
Lefty1 A T 1: 180,937,712 N282Y probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lrrn2 T C 1: 132,939,177 V660A probably benign Het
Lyst T C 13: 13,650,350 S1517P probably benign Het
Mcoln2 A G 3: 146,175,713 H208R probably benign Het
Mdga2 C T 12: 66,471,001 probably benign Het
Mpp2 T A 11: 102,064,433 E122V possibly damaging Het
Mrgprb5 T C 7: 48,168,778 N70D probably damaging Het
Muc5ac A T 7: 141,789,763 E37D possibly damaging Het
Nbeal1 T A 1: 60,235,563 probably null Het
Ncoa6 T C 2: 155,391,161 probably benign Het
Nfib C A 4: 82,504,730 probably null Het
Nostrin G T 2: 69,144,812 G24* probably null Het
Nudc A G 4: 133,533,265 Y293H probably damaging Het
Olfr643 T A 7: 104,058,733 N290Y probably damaging Het
Pcmtd1 T A 1: 7,155,101 Y41* probably null Het
Pigt T C 2: 164,501,624 L340P probably damaging Het
Pomgnt1 T C 4: 116,155,775 Y420H probably damaging Het
Pramel6 C T 2: 87,510,752 T476I probably benign Het
Ptprn2 T A 12: 116,824,396 H118Q possibly damaging Het
Rasl10a G A 11: 5,058,517 S71N probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Rps4l-ps T C 7: 114,927,302 noncoding transcript Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Secisbp2 T A 13: 51,652,732 F54L possibly damaging Het
Senp1 A T 15: 98,056,850 H484Q probably benign Het
Slc12a1 T C 2: 125,153,993 I22T possibly damaging Het
Slc25a36 A G 9: 97,090,119 probably benign Het
Srcap T A 7: 127,541,559 S1443T probably benign Het
Sv2c T C 13: 95,986,811 T385A probably benign Het
Tas2r131 T A 6: 132,956,973 H291L probably damaging Het
Thbs3 A G 3: 89,216,840 D80G probably damaging Het
Tnxb C T 17: 34,689,420 S1349L probably damaging Het
Toporsl A G 4: 52,611,996 R630G probably benign Het
Vmn1r43 C A 6: 89,869,855 M216I probably benign Het
Wdr17 T A 8: 54,639,876 E1068D probably benign Het
Wnt10a G A 1: 74,803,603 V413I probably damaging Het
Zfp141 T C 7: 42,476,687 probably null Het
Zfp169 T C 13: 48,490,158 I498V probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7917:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69274039 missense probably benign 0.09
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCTTTAAGGGAGGATTC -3'
(R):5'- GTGACAAATCTGGGTGGCTG -3'

Sequencing Primer
(F):5'- CCCCCGAGTGTCAATATCATATATC -3'
(R):5'- GGCTGTGGCAATGGCATG -3'
Posted On2015-10-21