Incidental Mutation 'R4719:Actr5'
ID354279
Institutional Source Beutler Lab
Gene Symbol Actr5
Ensembl Gene ENSMUSG00000037761
Gene NameARP5 actin-related protein 5
Synonyms
MMRRC Submission 041957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4719 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158624888-158639211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158626513 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 188 (S188T)
Ref Sequence ENSEMBL: ENSMUSP00000046658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045644] [ENSMUST00000183731]
Predicted Effect probably damaging
Transcript: ENSMUST00000045644
AA Change: S188T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046658
Gene: ENSMUSG00000037761
AA Change: S188T

DomainStartEndE-ValueType
ACTIN 30 571 1.15e-36 SMART
low complexity region 593 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142531
Predicted Effect probably benign
Transcript: ENSMUST00000183731
AA Change: S188T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139110
Gene: ENSMUSG00000037761
AA Change: S188T

DomainStartEndE-ValueType
ACTIN 30 399 3.1e-8 SMART
Meta Mutation Damage Score 0.2330 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,259,627 Y971C probably damaging Het
Adamtsl4 A G 3: 95,679,586 probably null Het
Agbl2 A G 2: 90,815,389 N822S probably benign Het
Ankdd1b T A 13: 96,417,747 probably benign Het
Arhgef40 C T 14: 52,004,938 probably benign Het
Art5 A G 7: 102,098,494 probably null Het
Cacna1s T C 1: 136,118,652 probably benign Het
Car9 G A 4: 43,508,616 W42* probably null Het
Cdh20 T C 1: 104,934,310 Y72H probably damaging Het
Ces1g T C 8: 93,317,090 D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 D73E probably benign Het
Col6a4 A T 9: 106,068,252 F888I probably damaging Het
Dgat2 T C 7: 99,158,297 D222G probably benign Het
Dscaml1 T C 9: 45,672,695 M486T probably benign Het
Faim2 C T 15: 99,527,579 probably null Het
Fam173b T G 15: 31,608,097 V98G probably damaging Het
Fance T C 17: 28,318,319 probably benign Het
Fancm G T 12: 65,121,706 M1614I possibly damaging Het
Fcrl5 A T 3: 87,444,189 N248I probably damaging Het
Foxo3 G A 10: 42,197,778 R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 Y74H probably damaging Het
Gatd1 A C 7: 141,411,068 D55E probably benign Het
Gpr152 C A 19: 4,143,224 Q255K possibly damaging Het
Havcr1 A G 11: 46,752,441 T63A probably benign Het
Hltf T C 3: 20,064,701 probably null Het
Ifit3b A T 19: 34,612,630 Q402L probably damaging Het
Ints3 A G 3: 90,415,521 L134S probably benign Het
Kcna10 A G 3: 107,194,901 T283A probably benign Het
Kmt2e A C 5: 23,492,315 R590S probably damaging Het
Lefty1 A T 1: 180,937,712 N282Y probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lrrn2 T C 1: 132,939,177 V660A probably benign Het
Lyst T C 13: 13,650,350 S1517P probably benign Het
Mcoln2 A G 3: 146,175,713 H208R probably benign Het
Mdga2 C T 12: 66,471,001 probably benign Het
Mpp2 T A 11: 102,064,433 E122V possibly damaging Het
Mrgprb5 T C 7: 48,168,778 N70D probably damaging Het
Muc5ac A T 7: 141,789,763 E37D possibly damaging Het
Nbeal1 T A 1: 60,235,563 probably null Het
Ncoa6 T C 2: 155,391,161 probably benign Het
Nfib C A 4: 82,504,730 probably null Het
Nostrin G T 2: 69,144,812 G24* probably null Het
Nudc A G 4: 133,533,265 Y293H probably damaging Het
Olfr643 T A 7: 104,058,733 N290Y probably damaging Het
Pcmtd1 T A 1: 7,155,101 Y41* probably null Het
Pigt T C 2: 164,501,624 L340P probably damaging Het
Pomgnt1 T C 4: 116,155,775 Y420H probably damaging Het
Pramel6 C T 2: 87,510,752 T476I probably benign Het
Ptprn2 T A 12: 116,824,396 H118Q possibly damaging Het
Rasl10a G A 11: 5,058,517 S71N probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Rps4l-ps T C 7: 114,927,302 noncoding transcript Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Secisbp2 T A 13: 51,652,732 F54L possibly damaging Het
Senp1 A T 15: 98,056,850 H484Q probably benign Het
Slc12a1 T C 2: 125,153,993 I22T possibly damaging Het
Slc25a36 A G 9: 97,090,119 probably benign Het
Srcap T A 7: 127,541,559 S1443T probably benign Het
Sv2c T C 13: 95,986,811 T385A probably benign Het
Tas2r131 T A 6: 132,956,973 H291L probably damaging Het
Thbs3 A G 3: 89,216,840 D80G probably damaging Het
Tnxb C T 17: 34,689,420 S1349L probably damaging Het
Toporsl A G 4: 52,611,996 R630G probably benign Het
Vmn1r43 C A 6: 89,869,855 M216I probably benign Het
Wdr17 T A 8: 54,639,876 E1068D probably benign Het
Wnt10a G A 1: 74,803,603 V413I probably damaging Het
Zfp141 T C 7: 42,476,687 probably null Het
Zfp169 T C 13: 48,490,158 I498V probably benign Het
Other mutations in Actr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Actr5 APN 2 158636802 critical splice donor site probably null
IGL02622:Actr5 APN 2 158638808 missense probably benign 0.03
IGL02707:Actr5 APN 2 158636697 missense probably benign 0.45
R0610:Actr5 UTSW 2 158632456 critical splice donor site probably null
R1467:Actr5 UTSW 2 158638697 missense probably benign 0.02
R1467:Actr5 UTSW 2 158638697 missense probably benign 0.02
R1720:Actr5 UTSW 2 158636137 missense possibly damaging 0.93
R1869:Actr5 UTSW 2 158638723 missense probably damaging 0.99
R1937:Actr5 UTSW 2 158636029 missense possibly damaging 0.63
R2051:Actr5 UTSW 2 158632293 missense probably benign 0.00
R2389:Actr5 UTSW 2 158625212 missense probably benign
R2420:Actr5 UTSW 2 158636081 missense probably damaging 1.00
R2422:Actr5 UTSW 2 158636081 missense probably damaging 1.00
R2909:Actr5 UTSW 2 158625220 missense possibly damaging 0.52
R4089:Actr5 UTSW 2 158625102 utr 5 prime probably benign
R4737:Actr5 UTSW 2 158628071 missense probably damaging 1.00
R4820:Actr5 UTSW 2 158625506 missense probably damaging 1.00
R5010:Actr5 UTSW 2 158635363 missense probably benign 0.00
R5341:Actr5 UTSW 2 158625224 nonsense probably null
R5457:Actr5 UTSW 2 158635998 splice site probably null
R6328:Actr5 UTSW 2 158635344 missense possibly damaging 0.72
R7158:Actr5 UTSW 2 158626414 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGTCTTTCAAAGTAGGGCTGC -3'
(R):5'- AACTTCTGAAGGCACTCACTG -3'

Sequencing Primer
(F):5'- CAAAGTAGGGCTGCGTTGATCATC -3'
(R):5'- CTTCTGAAGGCACTCACTGATGTAG -3'
Posted On2015-10-21