Incidental Mutation 'R4719:Car9'
ID 354288
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Name carbonic anhydrase 9
Synonyms CAIX, MN/CA9
MMRRC Submission 041957-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4719 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 43507026-43513729 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 43508616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 42 (W42*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183]
AlphaFold Q8VHB5
Predicted Effect probably null
Transcript: ENSMUST00000030183
AA Change: W128*
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463
AA Change: W128*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect probably null
Transcript: ENSMUST00000138073
AA Change: W42*
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463
AA Change: W42*

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,089,971 (GRCm39) Y971C probably damaging Het
Actr5 T A 2: 158,468,433 (GRCm39) S188T probably damaging Het
Adamtsl4 A G 3: 95,586,896 (GRCm39) probably null Het
Agbl2 A G 2: 90,645,733 (GRCm39) N822S probably benign Het
Ankdd1b T A 13: 96,554,255 (GRCm39) probably benign Het
Arhgef40 C T 14: 52,242,395 (GRCm39) probably benign Het
Art5 A G 7: 101,747,701 (GRCm39) probably null Het
Atpsckmt T G 15: 31,608,243 (GRCm39) V98G probably damaging Het
Cacna1s T C 1: 136,046,390 (GRCm39) probably benign Het
Cdh20 T C 1: 104,862,035 (GRCm39) Y72H probably damaging Het
Ces1g T C 8: 94,043,718 (GRCm39) D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 (GRCm39) D73E probably benign Het
Col6a4 A T 9: 105,945,451 (GRCm39) F888I probably damaging Het
Dgat2 T C 7: 98,807,504 (GRCm39) D222G probably benign Het
Dscaml1 T C 9: 45,583,993 (GRCm39) M486T probably benign Het
Faim2 C T 15: 99,425,460 (GRCm39) probably null Het
Fance T C 17: 28,537,293 (GRCm39) probably benign Het
Fancm G T 12: 65,168,480 (GRCm39) M1614I possibly damaging Het
Fcrl5 A T 3: 87,351,496 (GRCm39) N248I probably damaging Het
Foxo3 G A 10: 42,073,774 (GRCm39) R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 (GRCm39) Y74H probably damaging Het
Gatd1 A C 7: 140,990,981 (GRCm39) D55E probably benign Het
Gpr152 C A 19: 4,193,223 (GRCm39) Q255K possibly damaging Het
Havcr1 A G 11: 46,643,268 (GRCm39) T63A probably benign Het
Hltf T C 3: 20,118,865 (GRCm39) probably null Het
Ifit3b A T 19: 34,590,030 (GRCm39) Q402L probably damaging Het
Ints3 A G 3: 90,322,828 (GRCm39) L134S probably benign Het
Kcna10 A G 3: 107,102,217 (GRCm39) T283A probably benign Het
Kmt2e A C 5: 23,697,313 (GRCm39) R590S probably damaging Het
Lefty1 A T 1: 180,765,277 (GRCm39) N282Y probably benign Het
Loxl4 T A 19: 42,596,030 (GRCm39) Y141F probably benign Het
Lrrn2 T C 1: 132,866,915 (GRCm39) V660A probably benign Het
Lyst T C 13: 13,824,935 (GRCm39) S1517P probably benign Het
Mcoln2 A G 3: 145,881,468 (GRCm39) H208R probably benign Het
Mdga2 C T 12: 66,517,775 (GRCm39) probably benign Het
Mpp2 T A 11: 101,955,259 (GRCm39) E122V possibly damaging Het
Mrgprb5 T C 7: 47,818,526 (GRCm39) N70D probably damaging Het
Muc5ac A T 7: 141,343,500 (GRCm39) E37D possibly damaging Het
Nbeal1 T A 1: 60,274,722 (GRCm39) probably null Het
Ncoa6 T C 2: 155,233,081 (GRCm39) probably benign Het
Nfib C A 4: 82,422,967 (GRCm39) probably null Het
Nostrin G T 2: 68,975,156 (GRCm39) G24* probably null Het
Nudc A G 4: 133,260,576 (GRCm39) Y293H probably damaging Het
Or51a42 T A 7: 103,707,940 (GRCm39) N290Y probably damaging Het
Pcmtd1 T A 1: 7,225,325 (GRCm39) Y41* probably null Het
Pigt T C 2: 164,343,544 (GRCm39) L340P probably damaging Het
Pomgnt1 T C 4: 116,012,972 (GRCm39) Y420H probably damaging Het
Pramel6 C T 2: 87,341,096 (GRCm39) T476I probably benign Het
Ptprn2 T A 12: 116,788,016 (GRCm39) H118Q possibly damaging Het
Rasl10a G A 11: 5,008,517 (GRCm39) S71N probably benign Het
Rnf213 A G 11: 119,310,893 (GRCm39) I804V probably benign Het
Rps4l-ps T C 7: 114,526,537 (GRCm39) noncoding transcript Het
Sash1 T A 10: 8,605,477 (GRCm39) H971L probably benign Het
Secisbp2 T A 13: 51,806,768 (GRCm39) F54L possibly damaging Het
Senp1 A T 15: 97,954,731 (GRCm39) H484Q probably benign Het
Slc12a1 T C 2: 124,995,913 (GRCm39) I22T possibly damaging Het
Slc25a36 A G 9: 96,972,172 (GRCm39) probably benign Het
Srcap T A 7: 127,140,731 (GRCm39) S1443T probably benign Het
Sv2c T C 13: 96,123,319 (GRCm39) T385A probably benign Het
Tas2r131 T A 6: 132,933,936 (GRCm39) H291L probably damaging Het
Thbs3 A G 3: 89,124,147 (GRCm39) D80G probably damaging Het
Tnxb C T 17: 34,908,394 (GRCm39) S1349L probably damaging Het
Toporsl A G 4: 52,611,996 (GRCm39) R630G probably benign Het
Vmn1r43 C A 6: 89,846,837 (GRCm39) M216I probably benign Het
Wdr17 T A 8: 55,092,911 (GRCm39) E1068D probably benign Het
Wnt10a G A 1: 74,842,762 (GRCm39) V413I probably damaging Het
Zfp141 T C 7: 42,126,111 (GRCm39) probably null Het
Zfp169 T C 13: 48,643,634 (GRCm39) I498V probably benign Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43,512,941 (GRCm39) splice site probably benign
IGL01893:Car9 APN 4 43,510,252 (GRCm39) missense probably damaging 1.00
IGL02064:Car9 APN 4 43,507,363 (GRCm39) missense probably benign
R0122:Car9 UTSW 4 43,512,206 (GRCm39) missense probably benign 0.05
R0314:Car9 UTSW 4 43,509,212 (GRCm39) critical splice donor site probably null
R0497:Car9 UTSW 4 43,511,881 (GRCm39) missense probably damaging 1.00
R1018:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1132:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1218:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1219:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1222:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1350:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1351:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1352:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1353:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1389:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1417:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1573:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1818:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1819:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R4033:Car9 UTSW 4 43,508,624 (GRCm39) missense possibly damaging 0.52
R4597:Car9 UTSW 4 43,509,138 (GRCm39) missense probably damaging 1.00
R4609:Car9 UTSW 4 43,507,267 (GRCm39) missense possibly damaging 0.81
R5402:Car9 UTSW 4 43,510,213 (GRCm39) missense probably damaging 1.00
R5624:Car9 UTSW 4 43,509,146 (GRCm39) missense probably benign 0.03
R6471:Car9 UTSW 4 43,511,938 (GRCm39) missense probably damaging 1.00
R6850:Car9 UTSW 4 43,507,321 (GRCm39) missense probably damaging 0.96
R7318:Car9 UTSW 4 43,513,089 (GRCm39) missense probably damaging 0.99
R7680:Car9 UTSW 4 43,507,250 (GRCm39) missense probably damaging 0.96
R8378:Car9 UTSW 4 43,509,021 (GRCm39) missense probably damaging 1.00
R9313:Car9 UTSW 4 43,507,180 (GRCm39) missense probably benign 0.03
X0067:Car9 UTSW 4 43,507,198 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACCCAGGTCCTACTCTATGG -3'
(R):5'- CCAGCAGAACTCCTAAGTGC -3'

Sequencing Primer
(F):5'- AGGTCCTACTCTATGGCCCCC -3'
(R):5'- AAGTGCACAGCTTGATTGCC -3'
Posted On 2015-10-21