Incidental Mutation 'R4719:Kmt2e'
ID354293
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission 041957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4719 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23492315 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 590 (R590S)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000126586] [ENSMUST00000146375] [ENSMUST00000196260]
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: R590S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: R590S

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: R590S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: R590S

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000126586
Predicted Effect unknown
Transcript: ENSMUST00000146375
AA Change: D142A
SMART Domains Protein: ENSMUSP00000142547
Gene: ENSMUSG00000029004
AA Change: D142A

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157545
Predicted Effect probably damaging
Transcript: ENSMUST00000196260
AA Change: R70S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004
AA Change: R70S

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197591
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,259,627 Y971C probably damaging Het
Actr5 T A 2: 158,626,513 S188T probably damaging Het
Adamtsl4 A G 3: 95,679,586 probably null Het
Agbl2 A G 2: 90,815,389 N822S probably benign Het
Ankdd1b T A 13: 96,417,747 probably benign Het
Arhgef40 C T 14: 52,004,938 probably benign Het
Art5 A G 7: 102,098,494 probably null Het
Cacna1s T C 1: 136,118,652 probably benign Het
Car9 G A 4: 43,508,616 W42* probably null Het
Cdh20 T C 1: 104,934,310 Y72H probably damaging Het
Ces1g T C 8: 93,317,090 D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 D73E probably benign Het
Col6a4 A T 9: 106,068,252 F888I probably damaging Het
Dgat2 T C 7: 99,158,297 D222G probably benign Het
Dscaml1 T C 9: 45,672,695 M486T probably benign Het
Faim2 C T 15: 99,527,579 probably null Het
Fam173b T G 15: 31,608,097 V98G probably damaging Het
Fance T C 17: 28,318,319 probably benign Het
Fancm G T 12: 65,121,706 M1614I possibly damaging Het
Fcrl5 A T 3: 87,444,189 N248I probably damaging Het
Foxo3 G A 10: 42,197,778 R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 Y74H probably damaging Het
Gatd1 A C 7: 141,411,068 D55E probably benign Het
Gpr152 C A 19: 4,143,224 Q255K possibly damaging Het
Havcr1 A G 11: 46,752,441 T63A probably benign Het
Hltf T C 3: 20,064,701 probably null Het
Ifit3b A T 19: 34,612,630 Q402L probably damaging Het
Ints3 A G 3: 90,415,521 L134S probably benign Het
Kcna10 A G 3: 107,194,901 T283A probably benign Het
Lefty1 A T 1: 180,937,712 N282Y probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lrrn2 T C 1: 132,939,177 V660A probably benign Het
Lyst T C 13: 13,650,350 S1517P probably benign Het
Mcoln2 A G 3: 146,175,713 H208R probably benign Het
Mdga2 C T 12: 66,471,001 probably benign Het
Mpp2 T A 11: 102,064,433 E122V possibly damaging Het
Mrgprb5 T C 7: 48,168,778 N70D probably damaging Het
Muc5ac A T 7: 141,789,763 E37D possibly damaging Het
Nbeal1 T A 1: 60,235,563 probably null Het
Ncoa6 T C 2: 155,391,161 probably benign Het
Nfib C A 4: 82,504,730 probably null Het
Nostrin G T 2: 69,144,812 G24* probably null Het
Nudc A G 4: 133,533,265 Y293H probably damaging Het
Olfr643 T A 7: 104,058,733 N290Y probably damaging Het
Pcmtd1 T A 1: 7,155,101 Y41* probably null Het
Pigt T C 2: 164,501,624 L340P probably damaging Het
Pomgnt1 T C 4: 116,155,775 Y420H probably damaging Het
Pramel6 C T 2: 87,510,752 T476I probably benign Het
Ptprn2 T A 12: 116,824,396 H118Q possibly damaging Het
Rasl10a G A 11: 5,058,517 S71N probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Rps4l-ps T C 7: 114,927,302 noncoding transcript Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Secisbp2 T A 13: 51,652,732 F54L possibly damaging Het
Senp1 A T 15: 98,056,850 H484Q probably benign Het
Slc12a1 T C 2: 125,153,993 I22T possibly damaging Het
Slc25a36 A G 9: 97,090,119 probably benign Het
Srcap T A 7: 127,541,559 S1443T probably benign Het
Sv2c T C 13: 95,986,811 T385A probably benign Het
Tas2r131 T A 6: 132,956,973 H291L probably damaging Het
Thbs3 A G 3: 89,216,840 D80G probably damaging Het
Tnxb C T 17: 34,689,420 S1349L probably damaging Het
Toporsl A G 4: 52,611,996 R630G probably benign Het
Vmn1r43 C A 6: 89,869,855 M216I probably benign Het
Wdr17 T A 8: 54,639,876 E1068D probably benign Het
Wnt10a G A 1: 74,803,603 V413I probably damaging Het
Zfp141 T C 7: 42,476,687 probably null Het
Zfp169 T C 13: 48,490,158 I498V probably benign Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTGGCTGTAATCTGTTCCC -3'
(R):5'- GCCATCACTTTTATCATGGAACTC -3'

Sequencing Primer
(F):5'- AGTGGCTGTAATCTGTTCCCATACC -3'
(R):5'- CTACTGTGTAGAGACTTTAAGGCAC -3'
Posted On2015-10-21