Incidental Mutation 'R4719:Ptprn2'
ID354319
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission 041957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R4719 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116824396 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 118 (H118Q)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070733
AA Change: H118Q

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: H118Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189009
Predicted Effect possibly damaging
Transcript: ENSMUST00000190247
AA Change: H118Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: H118Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191106
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,259,627 Y971C probably damaging Het
Actr5 T A 2: 158,626,513 S188T probably damaging Het
Adamtsl4 A G 3: 95,679,586 probably null Het
Agbl2 A G 2: 90,815,389 N822S probably benign Het
Ankdd1b T A 13: 96,417,747 probably benign Het
Arhgef40 C T 14: 52,004,938 probably benign Het
Art5 A G 7: 102,098,494 probably null Het
Cacna1s T C 1: 136,118,652 probably benign Het
Car9 G A 4: 43,508,616 W42* probably null Het
Cdh20 T C 1: 104,934,310 Y72H probably damaging Het
Ces1g T C 8: 93,317,090 D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 D73E probably benign Het
Col6a4 A T 9: 106,068,252 F888I probably damaging Het
Dgat2 T C 7: 99,158,297 D222G probably benign Het
Dscaml1 T C 9: 45,672,695 M486T probably benign Het
Faim2 C T 15: 99,527,579 probably null Het
Fam173b T G 15: 31,608,097 V98G probably damaging Het
Fance T C 17: 28,318,319 probably benign Het
Fancm G T 12: 65,121,706 M1614I possibly damaging Het
Fcrl5 A T 3: 87,444,189 N248I probably damaging Het
Foxo3 G A 10: 42,197,778 R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 Y74H probably damaging Het
Gatd1 A C 7: 141,411,068 D55E probably benign Het
Gpr152 C A 19: 4,143,224 Q255K possibly damaging Het
Havcr1 A G 11: 46,752,441 T63A probably benign Het
Hltf T C 3: 20,064,701 probably null Het
Ifit3b A T 19: 34,612,630 Q402L probably damaging Het
Ints3 A G 3: 90,415,521 L134S probably benign Het
Kcna10 A G 3: 107,194,901 T283A probably benign Het
Kmt2e A C 5: 23,492,315 R590S probably damaging Het
Lefty1 A T 1: 180,937,712 N282Y probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lrrn2 T C 1: 132,939,177 V660A probably benign Het
Lyst T C 13: 13,650,350 S1517P probably benign Het
Mcoln2 A G 3: 146,175,713 H208R probably benign Het
Mdga2 C T 12: 66,471,001 probably benign Het
Mpp2 T A 11: 102,064,433 E122V possibly damaging Het
Mrgprb5 T C 7: 48,168,778 N70D probably damaging Het
Muc5ac A T 7: 141,789,763 E37D possibly damaging Het
Nbeal1 T A 1: 60,235,563 probably null Het
Ncoa6 T C 2: 155,391,161 probably benign Het
Nfib C A 4: 82,504,730 probably null Het
Nostrin G T 2: 69,144,812 G24* probably null Het
Nudc A G 4: 133,533,265 Y293H probably damaging Het
Olfr643 T A 7: 104,058,733 N290Y probably damaging Het
Pcmtd1 T A 1: 7,155,101 Y41* probably null Het
Pigt T C 2: 164,501,624 L340P probably damaging Het
Pomgnt1 T C 4: 116,155,775 Y420H probably damaging Het
Pramel6 C T 2: 87,510,752 T476I probably benign Het
Rasl10a G A 11: 5,058,517 S71N probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Rps4l-ps T C 7: 114,927,302 noncoding transcript Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Secisbp2 T A 13: 51,652,732 F54L possibly damaging Het
Senp1 A T 15: 98,056,850 H484Q probably benign Het
Slc12a1 T C 2: 125,153,993 I22T possibly damaging Het
Slc25a36 A G 9: 97,090,119 probably benign Het
Srcap T A 7: 127,541,559 S1443T probably benign Het
Sv2c T C 13: 95,986,811 T385A probably benign Het
Tas2r131 T A 6: 132,956,973 H291L probably damaging Het
Thbs3 A G 3: 89,216,840 D80G probably damaging Het
Tnxb C T 17: 34,689,420 S1349L probably damaging Het
Toporsl A G 4: 52,611,996 R630G probably benign Het
Vmn1r43 C A 6: 89,869,855 M216I probably benign Het
Wdr17 T A 8: 54,639,876 E1068D probably benign Het
Wnt10a G A 1: 74,803,603 V413I probably damaging Het
Zfp141 T C 7: 42,476,687 probably null Het
Zfp169 T C 13: 48,490,158 I498V probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CATGGTTTTCTGGAAGAACAGGG -3'
(R):5'- AGTGTCCAAGGCACCACATTTC -3'

Sequencing Primer
(F):5'- CAGGGACCTGTAGGAGTCTG -3'
(R):5'- GGCACCACATTTCAGGGTTAC -3'
Posted On2015-10-21