Incidental Mutation 'R4719:Sv2c'
ID 354323
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 041957-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4719 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96123319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 385 (T385A)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: T385A

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: T385A

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: T385A

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: T385A

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Meta Mutation Damage Score 0.1485 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,089,971 (GRCm39) Y971C probably damaging Het
Actr5 T A 2: 158,468,433 (GRCm39) S188T probably damaging Het
Adamtsl4 A G 3: 95,586,896 (GRCm39) probably null Het
Agbl2 A G 2: 90,645,733 (GRCm39) N822S probably benign Het
Ankdd1b T A 13: 96,554,255 (GRCm39) probably benign Het
Arhgef40 C T 14: 52,242,395 (GRCm39) probably benign Het
Art5 A G 7: 101,747,701 (GRCm39) probably null Het
Atpsckmt T G 15: 31,608,243 (GRCm39) V98G probably damaging Het
Cacna1s T C 1: 136,046,390 (GRCm39) probably benign Het
Car9 G A 4: 43,508,616 (GRCm39) W42* probably null Het
Cdh20 T C 1: 104,862,035 (GRCm39) Y72H probably damaging Het
Ces1g T C 8: 94,043,718 (GRCm39) D407G possibly damaging Het
Cngb3 T A 4: 19,309,562 (GRCm39) D73E probably benign Het
Col6a4 A T 9: 105,945,451 (GRCm39) F888I probably damaging Het
Dgat2 T C 7: 98,807,504 (GRCm39) D222G probably benign Het
Dscaml1 T C 9: 45,583,993 (GRCm39) M486T probably benign Het
Faim2 C T 15: 99,425,460 (GRCm39) probably null Het
Fance T C 17: 28,537,293 (GRCm39) probably benign Het
Fancm G T 12: 65,168,480 (GRCm39) M1614I possibly damaging Het
Fcrl5 A T 3: 87,351,496 (GRCm39) N248I probably damaging Het
Foxo3 G A 10: 42,073,774 (GRCm39) R29W probably damaging Het
Gabbr2 A G 4: 46,718,797 (GRCm39) Y74H probably damaging Het
Gatd1 A C 7: 140,990,981 (GRCm39) D55E probably benign Het
Gpr152 C A 19: 4,193,223 (GRCm39) Q255K possibly damaging Het
Havcr1 A G 11: 46,643,268 (GRCm39) T63A probably benign Het
Hltf T C 3: 20,118,865 (GRCm39) probably null Het
Ifit3b A T 19: 34,590,030 (GRCm39) Q402L probably damaging Het
Ints3 A G 3: 90,322,828 (GRCm39) L134S probably benign Het
Kcna10 A G 3: 107,102,217 (GRCm39) T283A probably benign Het
Kmt2e A C 5: 23,697,313 (GRCm39) R590S probably damaging Het
Lefty1 A T 1: 180,765,277 (GRCm39) N282Y probably benign Het
Loxl4 T A 19: 42,596,030 (GRCm39) Y141F probably benign Het
Lrrn2 T C 1: 132,866,915 (GRCm39) V660A probably benign Het
Lyst T C 13: 13,824,935 (GRCm39) S1517P probably benign Het
Mcoln2 A G 3: 145,881,468 (GRCm39) H208R probably benign Het
Mdga2 C T 12: 66,517,775 (GRCm39) probably benign Het
Mpp2 T A 11: 101,955,259 (GRCm39) E122V possibly damaging Het
Mrgprb5 T C 7: 47,818,526 (GRCm39) N70D probably damaging Het
Muc5ac A T 7: 141,343,500 (GRCm39) E37D possibly damaging Het
Nbeal1 T A 1: 60,274,722 (GRCm39) probably null Het
Ncoa6 T C 2: 155,233,081 (GRCm39) probably benign Het
Nfib C A 4: 82,422,967 (GRCm39) probably null Het
Nostrin G T 2: 68,975,156 (GRCm39) G24* probably null Het
Nudc A G 4: 133,260,576 (GRCm39) Y293H probably damaging Het
Or51a42 T A 7: 103,707,940 (GRCm39) N290Y probably damaging Het
Pcmtd1 T A 1: 7,225,325 (GRCm39) Y41* probably null Het
Pigt T C 2: 164,343,544 (GRCm39) L340P probably damaging Het
Pomgnt1 T C 4: 116,012,972 (GRCm39) Y420H probably damaging Het
Pramel6 C T 2: 87,341,096 (GRCm39) T476I probably benign Het
Ptprn2 T A 12: 116,788,016 (GRCm39) H118Q possibly damaging Het
Rasl10a G A 11: 5,008,517 (GRCm39) S71N probably benign Het
Rnf213 A G 11: 119,310,893 (GRCm39) I804V probably benign Het
Rps4l-ps T C 7: 114,526,537 (GRCm39) noncoding transcript Het
Sash1 T A 10: 8,605,477 (GRCm39) H971L probably benign Het
Secisbp2 T A 13: 51,806,768 (GRCm39) F54L possibly damaging Het
Senp1 A T 15: 97,954,731 (GRCm39) H484Q probably benign Het
Slc12a1 T C 2: 124,995,913 (GRCm39) I22T possibly damaging Het
Slc25a36 A G 9: 96,972,172 (GRCm39) probably benign Het
Srcap T A 7: 127,140,731 (GRCm39) S1443T probably benign Het
Tas2r131 T A 6: 132,933,936 (GRCm39) H291L probably damaging Het
Thbs3 A G 3: 89,124,147 (GRCm39) D80G probably damaging Het
Tnxb C T 17: 34,908,394 (GRCm39) S1349L probably damaging Het
Toporsl A G 4: 52,611,996 (GRCm39) R630G probably benign Het
Vmn1r43 C A 6: 89,846,837 (GRCm39) M216I probably benign Het
Wdr17 T A 8: 55,092,911 (GRCm39) E1068D probably benign Het
Wnt10a G A 1: 74,842,762 (GRCm39) V413I probably damaging Het
Zfp141 T C 7: 42,126,111 (GRCm39) probably null Het
Zfp169 T C 13: 48,643,634 (GRCm39) I498V probably benign Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGGTCCTAATGCAAGAGAC -3'
(R):5'- GCATCTGTAGATCTCTGCCAG -3'

Sequencing Primer
(F):5'- GTCCTAGATAGAGGGACACTTCC -3'
(R):5'- GCCAGTGTTCTCCTATGTATGAAC -3'
Posted On 2015-10-21