Incidental Mutation 'R4720:Kcnq5'
ID354333
Institutional Source Beutler Lab
Gene Symbol Kcnq5
Ensembl Gene ENSMUSG00000028033
Gene Namepotassium voltage-gated channel, subfamily Q, member 5
Synonyms9230107O05Rik, D1Mgi1
MMRRC Submission 041958-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location21398403-21961942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21403050 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 630 (A630T)
Ref Sequence ENSEMBL: ENSMUSP00000134076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029667] [ENSMUST00000115300] [ENSMUST00000173058] [ENSMUST00000173404] [ENSMUST00000174183]
Predicted Effect probably benign
Transcript: ENSMUST00000029667
AA Change: A639T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029667
Gene: ENSMUSG00000028033
AA Change: A639T

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 1.7e-26 PFAM
Pfam:Ion_trans_2 272 352 5.3e-15 PFAM
Pfam:KCNQ_channel 446 648 3.6e-95 PFAM
low complexity region 848 858 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115300
AA Change: A658T

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110955
Gene: ENSMUSG00000028033
AA Change: A658T

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
Pfam:Ion_trans 126 359 4.1e-28 PFAM
Pfam:Ion_trans_2 272 352 3.3e-16 PFAM
Pfam:KCNQ_channel 467 661 1.8e-98 PFAM
low complexity region 867 877 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173058
AA Change: A529T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134166
Gene: ENSMUSG00000028033
AA Change: A529T

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2e-26 PFAM
Pfam:Ion_trans_2 272 352 3.1e-15 PFAM
Pfam:KCNQ_channel 405 538 8e-64 PFAM
low complexity region 738 748 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173404
AA Change: A630T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134076
Gene: ENSMUSG00000028033
AA Change: A630T

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2.4e-26 PFAM
Pfam:Ion_trans_2 272 352 3.6e-15 PFAM
Pfam:KCNQ_channel 437 639 2e-95 PFAM
low complexity region 839 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174183
SMART Domains Protein: ENSMUSP00000134389
Gene: ENSMUSG00000028033

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KCNQ potassium channel gene family that is differentially expressed in subregions of the brain and in skeletal muscle. The protein encoded by this gene yields currents that activate slowly with depolarization and can form heteromeric channels with the protein encoded by the KCNQ3 gene. Currents expressed from this protein have voltage dependences and inhibitor sensitivities in common with M-currents. They are also inhibited by M1 muscarinic receptor activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a dominant negative knock-in mutation in this gene exhibit partial prenatal lethality and abnormal afterhyperpolarization in the in the CA3 area of hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Kcnq5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Kcnq5 APN 1 21505763 missense probably damaging 1.00
IGL01603:Kcnq5 APN 1 21505340 missense possibly damaging 0.94
IGL02326:Kcnq5 APN 1 21402592 missense probably benign 0.17
IGL02624:Kcnq5 APN 1 21402430 missense probably benign 0.27
IGL03151:Kcnq5 APN 1 21535069 missense probably damaging 1.00
IGL03367:Kcnq5 APN 1 21403065 missense probably damaging 1.00
PIT1430001:Kcnq5 UTSW 1 21535181 missense probably damaging 1.00
R0705:Kcnq5 UTSW 1 21535177 missense probably damaging 1.00
R0798:Kcnq5 UTSW 1 21961175 splice site probably null
R1263:Kcnq5 UTSW 1 21479378 missense probably damaging 1.00
R1445:Kcnq5 UTSW 1 21405024 missense probably benign 0.01
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1497:Kcnq5 UTSW 1 21402386 missense possibly damaging 0.82
R1515:Kcnq5 UTSW 1 21402681 missense probably benign 0.01
R1610:Kcnq5 UTSW 1 21457461 missense probably damaging 1.00
R1835:Kcnq5 UTSW 1 21466387 missense probably benign 0.04
R1999:Kcnq5 UTSW 1 21402204 missense probably null 0.18
R2060:Kcnq5 UTSW 1 21461597 missense probably benign 0.06
R2145:Kcnq5 UTSW 1 21505349 missense probably damaging 0.96
R2314:Kcnq5 UTSW 1 21479371 splice site probably null
R2511:Kcnq5 UTSW 1 21505782 nonsense probably null
R2697:Kcnq5 UTSW 1 21479432 missense probably damaging 1.00
R2886:Kcnq5 UTSW 1 21469547 nonsense probably null
R2889:Kcnq5 UTSW 1 21402302 missense probably damaging 0.98
R4176:Kcnq5 UTSW 1 21535168 missense probably damaging 1.00
R4609:Kcnq5 UTSW 1 21405068 splice site probably null
R4904:Kcnq5 UTSW 1 21424100 missense probably damaging 0.98
R5184:Kcnq5 UTSW 1 21402487 missense probably damaging 1.00
R5268:Kcnq5 UTSW 1 21505725 missense probably damaging 1.00
R5373:Kcnq5 UTSW 1 21961571 missense unknown
R5397:Kcnq5 UTSW 1 21405856 missense probably damaging 1.00
R5473:Kcnq5 UTSW 1 21457402 critical splice donor site probably null
R5490:Kcnq5 UTSW 1 21479468 missense probably damaging 1.00
R5946:Kcnq5 UTSW 1 21505707 missense probably damaging 1.00
R6941:Kcnq5 UTSW 1 21405844 missense probably damaging 1.00
R6962:Kcnq5 UTSW 1 21505793 missense probably damaging 1.00
R7201:Kcnq5 UTSW 1 21402875 missense possibly damaging 0.93
R7238:Kcnq5 UTSW 1 21402302 missense probably benign 0.39
R7375:Kcnq5 UTSW 1 21469486 missense possibly damaging 0.82
R7584:Kcnq5 UTSW 1 21402321 missense probably benign
R7780:Kcnq5 UTSW 1 21961331 missense probably benign 0.43
R8043:Kcnq5 UTSW 1 21479420 missense probably damaging 1.00
R8103:Kcnq5 UTSW 1 21479396 missense possibly damaging 0.89
R8267:Kcnq5 UTSW 1 21505385 missense probably damaging 1.00
R8363:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8364:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8370:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8371:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8372:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8374:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8414:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8528:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
R8542:Kcnq5 UTSW 1 21479424 missense probably damaging 1.00
Z1088:Kcnq5 UTSW 1 21457529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGAGCACTGAACTCATTTGG -3'
(R):5'- AGTTAAAACTGGAGTGGCCTTC -3'

Sequencing Primer
(F):5'- AGCACTGAACTCATTTGGTGTTAG -3'
(R):5'- AACTGGAGTGGCCTTCATAGTAG -3'
Posted On2015-10-21