Incidental Mutation 'R4720:Rims1'
ID354334
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Nameregulating synaptic membrane exocytosis 1
SynonymsRIM1a, RIM1, RIM1alpha, C030033M19Rik
MMRRC Submission 041958-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.527) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location22286251-22805994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22427481 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 808 (Y808H)
Ref Sequence ENSEMBL: ENSMUSP00000080259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]
Predicted Effect probably damaging
Transcript: ENSMUST00000081544
AA Change: Y808H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: Y808H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097809
AA Change: Y808H

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: Y808H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097810
AA Change: Y808H

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: Y808H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097811
AA Change: Y808H

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: Y808H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115273
AA Change: Y808H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: Y808H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000185942
AA Change: Y112H
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22468242 missense probably damaging 1.00
IGL00535:Rims1 APN 1 22432921 missense probably benign 0.02
IGL01021:Rims1 APN 1 22486620 missense probably damaging 1.00
IGL01106:Rims1 APN 1 22379447 missense probably damaging 1.00
IGL01128:Rims1 APN 1 22534175 missense probably damaging 0.97
IGL01548:Rims1 APN 1 22538602 missense probably damaging 1.00
IGL01688:Rims1 APN 1 22397540 missense probably benign 0.22
IGL02089:Rims1 APN 1 22630475 missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22346488 missense probably damaging 0.98
IGL02355:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02362:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02682:Rims1 APN 1 22288484 missense probably damaging 1.00
IGL03006:Rims1 APN 1 22296954 missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22290109 missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22397460 missense
R0031:Rims1 UTSW 1 22296879 missense probably damaging 1.00
R0118:Rims1 UTSW 1 22346407 missense probably damaging 1.00
R0390:Rims1 UTSW 1 22596526 missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22468182 splice site probably benign
R0744:Rims1 UTSW 1 22427459 splice site probably null
R0836:Rims1 UTSW 1 22427459 splice site probably null
R1218:Rims1 UTSW 1 22483175 missense probably damaging 1.00
R1228:Rims1 UTSW 1 22472756 missense probably null 1.00
R1374:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1474:Rims1 UTSW 1 22538281 splice site probably benign
R1652:Rims1 UTSW 1 22292866 missense probably damaging 1.00
R1712:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1730:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22596558 missense probably damaging 1.00
R1899:Rims1 UTSW 1 22428474 missense probably damaging 1.00
R1937:Rims1 UTSW 1 22288530 missense probably damaging 1.00
R2010:Rims1 UTSW 1 22296996 missense probably damaging 1.00
R2049:Rims1 UTSW 1 22596435 missense probably damaging 1.00
R2124:Rims1 UTSW 1 22404508 nonsense probably null
R2860:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2861:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2914:Rims1 UTSW 1 22805630 missense probably damaging 1.00
R3740:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3741:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3773:Rims1 UTSW 1 22421810 missense probably damaging 1.00
R3874:Rims1 UTSW 1 22428489 missense probably damaging 1.00
R3901:Rims1 UTSW 1 22533497 missense probably benign 0.00
R3964:Rims1 UTSW 1 22427459 splice site probably null
R4037:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4039:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4056:Rims1 UTSW 1 22292939 splice site probably benign
R4062:Rims1 UTSW 1 22533583 missense probably benign 0.00
R4552:Rims1 UTSW 1 22373494 missense probably damaging 0.99
R4658:Rims1 UTSW 1 22427543 missense probably damaging 0.98
R4688:Rims1 UTSW 1 22479447 nonsense probably null
R4696:Rims1 UTSW 1 22288612 missense probably damaging 1.00
R4764:Rims1 UTSW 1 22479462 missense probably damaging 1.00
R4780:Rims1 UTSW 1 22291105 missense probably damaging 1.00
R4931:Rims1 UTSW 1 22533947 missense probably benign 0.26
R5137:Rims1 UTSW 1 22288620 nonsense probably null
R5153:Rims1 UTSW 1 22483247 nonsense probably null
R5305:Rims1 UTSW 1 22596542 missense probably damaging 0.99
R5354:Rims1 UTSW 1 22538511 missense probably damaging 1.00
R5386:Rims1 UTSW 1 22412245 missense probably damaging 0.99
R5485:Rims1 UTSW 1 22483208 missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22538509 missense probably damaging 1.00
R5929:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R5988:Rims1 UTSW 1 22596463 missense probably damaging 1.00
R6160:Rims1 UTSW 1 22432984 missense probably damaging 0.98
R6579:Rims1 UTSW 1 22425916 missense probably damaging 1.00
R6790:Rims1 UTSW 1 22468197 missense probably damaging 1.00
R7048:Rims1 UTSW 1 22472820 missense probably damaging 1.00
R7100:Rims1 UTSW 1 22346473 missense probably benign 0.27
R7155:Rims1 UTSW 1 22432923 missense probably damaging 0.99
R7171:Rims1 UTSW 1 22428489 missense
R7448:Rims1 UTSW 1 22404475 missense
R7505:Rims1 UTSW 1 22533996 missense possibly damaging 0.55
R7567:Rims1 UTSW 1 22468210 missense probably damaging 0.99
R7639:Rims1 UTSW 1 22805669 missense probably benign 0.02
R7955:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R8005:Rims1 UTSW 1 22412213 missense
R8071:Rims1 UTSW 1 22288536 nonsense probably null
R8465:Rims1 UTSW 1 22428480 missense possibly damaging 0.89
R8517:Rims1 UTSW 1 22483165 missense probably damaging 1.00
Z1088:Rims1 UTSW 1 22288586 missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22484671 nonsense probably null
Z1177:Rims1 UTSW 1 22296939 missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22468241 missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22472777 missense probably benign 0.44
Z1177:Rims1 UTSW 1 22472804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTGACTGAGTGTCTTTGAGAG -3'
(R):5'- AGGCCATGTGTTAGCCAGTTAC -3'

Sequencing Primer
(F):5'- TGAGAGTTGCTAATGTGTAAGGAATG -3'
(R):5'- CCATGTGTTAGCCAGTTACTGTCTG -3'
Posted On2015-10-21