Incidental Mutation 'R4720:Il1rl1'
ID354335
Institutional Source Beutler Lab
Gene Symbol Il1rl1
Ensembl Gene ENSMUSG00000026069
Gene Nameinterleukin 1 receptor-like 1
SynonymsT1 gene, St2-rs1, ST2, T1, T1/ST2, Ly84, Fit-1, DER4, St2, ST2L
MMRRC Submission 041958-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location40429570-40465415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40446678 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 330 (K330E)
Ref Sequence ENSEMBL: ENSMUSP00000134351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053043] [ENSMUST00000097772] [ENSMUST00000173514] [ENSMUST00000174335]
Predicted Effect probably benign
Transcript: ENSMUST00000053043
SMART Domains Protein: ENSMUSP00000054914
Gene: ENSMUSG00000026069

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
transmembrane domain 333 355 N/A INTRINSIC
TIR 381 543 4.23e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097772
SMART Domains Protein: ENSMUSP00000095379
Gene: ENSMUSG00000026069

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
transmembrane domain 333 355 N/A INTRINSIC
TIR 381 543 4.23e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173514
AA Change: K330E

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133784
Gene: ENSMUSG00000026069
AA Change: K330E

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174335
AA Change: K330E

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134351
Gene: ENSMUSG00000026069
AA Change: K330E

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal Th2 type inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Il1rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Il1rl1 APN 1 40446216 missense possibly damaging 0.75
IGL01413:Il1rl1 APN 1 40446169 missense possibly damaging 0.85
IGL01939:Il1rl1 APN 1 40462008 missense possibly damaging 0.80
IGL02121:Il1rl1 APN 1 40442303 splice site probably benign
IGL02160:Il1rl1 APN 1 40461837 missense probably benign 0.00
IGL02695:Il1rl1 APN 1 40446558 missense possibly damaging 0.47
R0007:Il1rl1 UTSW 1 40446171 missense possibly damaging 0.95
R0105:Il1rl1 UTSW 1 40442574 splice site probably benign
R0200:Il1rl1 UTSW 1 40441303 missense possibly damaging 0.95
R0363:Il1rl1 UTSW 1 40442574 splice site probably benign
R0508:Il1rl1 UTSW 1 40451717 missense possibly damaging 0.87
R0637:Il1rl1 UTSW 1 40442574 splice site probably benign
R0676:Il1rl1 UTSW 1 40442574 splice site probably benign
R1371:Il1rl1 UTSW 1 40442713 missense probably damaging 0.96
R2074:Il1rl1 UTSW 1 40462044 missense probably damaging 0.99
R2309:Il1rl1 UTSW 1 40442657 missense possibly damaging 0.46
R2426:Il1rl1 UTSW 1 40446619 missense probably damaging 1.00
R3983:Il1rl1 UTSW 1 40446663 missense possibly damaging 0.73
R4601:Il1rl1 UTSW 1 40441300 missense possibly damaging 0.88
R4707:Il1rl1 UTSW 1 40450188 missense probably damaging 0.96
R4784:Il1rl1 UTSW 1 40450188 missense probably damaging 0.96
R5137:Il1rl1 UTSW 1 40450125 missense probably benign
R5765:Il1rl1 UTSW 1 40461943 missense probably benign 0.06
R5953:Il1rl1 UTSW 1 40442673 missense probably benign 0.05
R6339:Il1rl1 UTSW 1 40461856 missense possibly damaging 0.88
R7176:Il1rl1 UTSW 1 40446606 missense probably damaging 1.00
R7677:Il1rl1 UTSW 1 40446704 makesense probably null
R8129:Il1rl1 UTSW 1 40451827 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAAACATCCCTCTGTGCC -3'
(R):5'- AAAGACCAGATTTAAGGAGCTTCC -3'

Sequencing Primer
(F):5'- TCACAGCTGGCACTTGC -3'
(R):5'- GGAGCTTCCTCAACGTGAG -3'
Posted On2015-10-21