Incidental Mutation 'R4720:Nvl'
ID354344
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Namenuclear VCP-like
Synonyms1200009I24Rik
MMRRC Submission 041958-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location181087138-181144204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181101587 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 743 (L743P)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
PDB Structure
Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000027797
AA Change: L743P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: L743P

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191728
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 181105125 missense probably damaging 1.00
IGL00943:Nvl APN 1 181101634 missense possibly damaging 0.72
IGL01956:Nvl APN 1 181134944 missense probably benign 0.00
IGL02657:Nvl APN 1 181106976 missense probably damaging 1.00
nineveh UTSW 1 181136906 missense probably benign 0.00
nubia UTSW 1 181112334 missense probably benign 0.19
IGL03098:Nvl UTSW 1 181093906 missense probably benign 0.37
P0047:Nvl UTSW 1 181112302 missense probably damaging 1.00
R0003:Nvl UTSW 1 181114133 missense probably damaging 1.00
R0114:Nvl UTSW 1 181120391 missense probably benign 0.19
R0265:Nvl UTSW 1 181134830 missense probably damaging 0.96
R0928:Nvl UTSW 1 181093902 missense probably benign 0.00
R1398:Nvl UTSW 1 181097126 splice site probably benign
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1529:Nvl UTSW 1 181109159 critical splice donor site probably null
R1934:Nvl UTSW 1 181099128 missense probably damaging 0.96
R2176:Nvl UTSW 1 181135074 splice site probably benign
R2351:Nvl UTSW 1 181130792 missense probably benign 0.03
R4415:Nvl UTSW 1 181105114 missense probably benign
R4570:Nvl UTSW 1 181144082 missense probably benign 0.03
R4888:Nvl UTSW 1 181117626 missense probably damaging 1.00
R5026:Nvl UTSW 1 181105155 missense probably damaging 1.00
R5507:Nvl UTSW 1 181135036 missense probably damaging 0.98
R5785:Nvl UTSW 1 181139298 missense probably damaging 1.00
R5983:Nvl UTSW 1 181136906 missense probably benign 0.00
R6143:Nvl UTSW 1 181134995 missense probably benign 0.01
R6532:Nvl UTSW 1 181144143 splice site probably null
R6821:Nvl UTSW 1 181126970 nonsense probably null
R7062:Nvl UTSW 1 181112334 missense probably benign 0.19
R7247:Nvl UTSW 1 181112286 critical splice donor site probably null
R7358:Nvl UTSW 1 181135036 missense probably damaging 0.98
R7665:Nvl UTSW 1 181134944 missense probably benign 0.18
R7795:Nvl UTSW 1 181097157 missense probably benign 0.00
R7931:Nvl UTSW 1 181109155 splice site probably benign
R8185:Nvl UTSW 1 181144174 unclassified probably benign
X0067:Nvl UTSW 1 181139158 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CCTGGATAACTTTAAAAGTGGAGTG -3'
(R):5'- AGGGTGTGTGCATGAAACC -3'

Sequencing Primer
(F):5'- TTACTGGGCAGCTACATACATGCAG -3'
(R):5'- AGGATTCCTCATTGAACCAGG -3'
Posted On2015-10-21