Incidental Mutation 'R4720:Helz2'
ID354354
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission 041958-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181238417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 502 (D502G)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: D502G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: D502G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108831
AA Change: D502G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: D502G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: D502G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: D502G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
R7372:Helz2 UTSW 2 181238423 missense possibly damaging 0.61
R7512:Helz2 UTSW 2 181230854 missense probably benign 0.00
R7512:Helz2 UTSW 2 181235600 splice site probably null
R7583:Helz2 UTSW 2 181237572 missense probably benign 0.06
R7724:Helz2 UTSW 2 181231996 missense probably damaging 1.00
R7733:Helz2 UTSW 2 181230355 missense possibly damaging 0.63
R7748:Helz2 UTSW 2 181234531 missense probably damaging 1.00
R7774:Helz2 UTSW 2 181233991 missense probably benign
R7799:Helz2 UTSW 2 181237989 missense probably benign 0.15
R7841:Helz2 UTSW 2 181232902 missense probably damaging 1.00
R7939:Helz2 UTSW 2 181237750 missense probably damaging 0.99
R8026:Helz2 UTSW 2 181240205 missense probably benign 0.34
R8030:Helz2 UTSW 2 181237896 missense possibly damaging 0.55
R8080:Helz2 UTSW 2 181238262 missense probably damaging 0.99
R8237:Helz2 UTSW 2 181229331 missense possibly damaging 0.65
R8245:Helz2 UTSW 2 181238102 missense probably damaging 1.00
R8304:Helz2 UTSW 2 181230157 missense probably benign 0.03
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Z1176:Helz2 UTSW 2 181237564 missense probably benign 0.39
Z1177:Helz2 UTSW 2 181235961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGGTAACTTGTACTTGGCC -3'
(R):5'- CCAGGATCCCTTGCTACATG -3'

Sequencing Primer
(F):5'- AACTTGTACTTGGCCATCAGG -3'
(R):5'- TGTGGCCCTACTCAATCAAGAG -3'
Posted On2015-10-21