Mutagenetix > Incidental Mutations

Incidental Mutation 'R4720:Ift80'

354355

Institutional Source

Beutler Lab

Gene Symbol

Ift80

Ensembl Gene

ENSMUSG00000027778

Gene Name

intraflagellar transport 80

Synonyms

4921524P20Rik, Wdr56

MMRRC Submission

041958-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R4720 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68892499-69004570 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68962290 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 223 (Y223H)

Ref Sequence

ENSEMBL: ENSMUSP00000133263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000154741] [ENSMUST00000169064]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029347
AA Change: Y223H

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: Y223H

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107812
AA Change: Y223H

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: Y223H

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152502

Predicted Effect

probably benign
Transcript: ENSMUST00000154741

SMART Domains

Protein: ENSMUSP00000118406
Gene: ENSMUSG00000027778

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	9e-10	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	209	2.12e2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169064
AA Change: Y223H

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: Y223H

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176754

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,127,422	I1124T	probably damaging	Het
Acacb	A	G	5: 114,229,914	T1658A	possibly damaging	Het
Acvrl1	C	A	15: 101,135,773	P112Q	probably damaging	Het
Als2cr12	T	C	1: 58,678,348	I135V	possibly damaging	Het
Ankar	A	T	1: 72,699,011	I4K	possibly damaging	Het
Ankfn1	G	C	11: 89,441,426	D431E	possibly damaging	Het
Apobec4	T	C	1: 152,756,674	V151A	possibly damaging	Het
Atp10b	A	G	11: 43,203,122	S498G	probably benign	Het
Azin1	A	G	15: 38,493,500	V293A	probably benign	Het
Ccdc88b	T	C	19: 6,857,715	E46G	probably damaging	Het
Ccdc96	T	C	5: 36,484,875		probably benign	Het
Ccnyl1	A	G	1: 64,713,131	D169G	probably benign	Het
Cdca3	T	A	6: 124,832,164	V89E	probably damaging	Het
Cdh19	A	T	1: 110,895,381		probably null	Het
Chka	G	A	19: 3,886,375	V238I	probably damaging	Het
Cntn3	T	C	6: 102,242,022	K546E	possibly damaging	Het
Crybg3	A	G	16: 59,539,817	V787A	probably damaging	Het
Dlgap3	T	C	4: 127,195,715		probably null	Het
Dnah8	C	T	17: 30,683,634	L889F	probably benign	Het
Dnah9	T	C	11: 66,076,358	E1658G	probably damaging	Het
Dnajc11	A	G	4: 151,968,539	D102G	probably damaging	Het
Dync1i2	T	G	2: 71,233,674	S121A	probably damaging	Het
Ece1	G	A	4: 137,957,175	E591K	probably damaging	Het
Enthd1	G	A	15: 80,560,309	S15L	probably damaging	Het
Epb41l2	T	A	10: 25,471,626	H372Q	probably damaging	Het
Errfi1	T	A	4: 150,866,747	Y211N	probably damaging	Het
Fam193b	G	A	13: 55,543,437	T208M	probably benign	Het
Fmnl2	C	T	2: 53,107,540	T501M	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm340	G	C	19: 41,585,895	A1030P	probably benign	Het
Gm4841	G	T	18: 60,270,063	D319E	probably benign	Het
Gm5724	C	A	6: 141,723,222	A495S	probably damaging	Het
Gucd1	A	G	10: 75,509,660	F187S	probably damaging	Het
Hcar2	GCGGATGCGCAC	GC	5: 123,864,689		probably null	Het
Helz2	T	C	2: 181,238,417	D502G	probably damaging	Het
Hspa2	A	G	12: 76,404,865	E111G	possibly damaging	Het
Htr2a	T	A	14: 74,645,059	S162T	probably damaging	Het
Il1rl1	A	G	1: 40,446,678	K330E	probably benign	Het
Il23r	A	T	6: 67,423,661	F562I	probably damaging	Het
Isx	T	C	8: 74,873,859		probably null	Het
Jcad	G	A	18: 4,674,055	V606I	probably benign	Het
Kcnn2	A	T	18: 45,683,120	T333S	possibly damaging	Het
Kcnq5	C	T	1: 21,403,050	A630T	probably damaging	Het
Kif2c	T	C	4: 117,171,749	M188V	probably benign	Het
Kntc1	T	C	5: 123,765,023	V321A	possibly damaging	Het
Krtap4-8	A	T	11: 99,780,445		probably benign	Het
Lgals3bp	A	C	11: 118,398,469	L52R	probably damaging	Het
Lipk	C	A	19: 34,021,699	H126Q	probably damaging	Het
Lpgat1	T	C	1: 191,763,667	Y323H	probably damaging	Het
Lrp2	T	G	2: 69,481,173	N2654H	probably damaging	Het
Lsm14b	C	T	2: 180,027,981	Q6*	probably null	Het
Lysmd3	C	T	13: 81,669,465	A187V	possibly damaging	Het
Map2k5	A	G	9: 63,293,719	S211P	probably damaging	Het
Mlph	A	T	1: 90,941,697	I474F	probably damaging	Het
Mpped2	T	C	2: 106,783,746	S142P	probably damaging	Het
Nemf	A	C	12: 69,324,288	M678R	probably benign	Het
Nfe2l1	A	T	11: 96,827,689	Y7N	probably damaging	Het
Nfkbie	T	G	17: 45,556,306	D122E	probably benign	Het
Noc3l	C	A	19: 38,789,622	A783S	probably benign	Het
Nol8	T	C	13: 49,662,753	V761A	probably damaging	Het
Nvl	A	G	1: 181,101,587	L743P	probably damaging	Het
Olfr3	T	A	2: 36,812,472	I207F	probably benign	Het
Plcb1	A	G	2: 135,251,747	K160R	possibly damaging	Het
Plekhg3	G	T	12: 76,578,322	G1313C	possibly damaging	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Popdc3	G	A	10: 45,314,906	V38I	probably benign	Het
Prdx3	A	T	19: 60,870,113	V114D	possibly damaging	Het
Prkdc	T	A	16: 15,667,715	S469T	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Reln	A	T	5: 22,286,896	F113I	possibly damaging	Het
Rims1	A	G	1: 22,427,481	Y808H	probably damaging	Het
Rsbn1	C	A	3: 103,929,020	T458N	possibly damaging	Het
Serpina3b	A	G	12: 104,130,630	S57G	possibly damaging	Het
Skor2	G	T	18: 76,861,183		probably null	Het
Slc22a4	A	T	11: 53,988,893	Y447N	probably damaging	Het
Stx19	G	T	16: 62,822,319	R166L	probably damaging	Het
Svep1	T	C	4: 58,205,869	T170A	possibly damaging	Het
Sycp2	T	G	2: 178,374,432	S746R	probably benign	Het
Tchh	G	T	3: 93,447,882	R1543L	unknown	Het
Tjp2	T	C	19: 24,100,805	D908G	probably damaging	Het
Ttc8	C	A	12: 98,979,809	A452E	possibly damaging	Het
Unc5a	T	A	13: 55,003,883	W709R	probably null	Het
Unc80	T	A	1: 66,510,792	S736R	possibly damaging	Het
Vmn2r100	C	A	17: 19,522,526	H387Q	probably benign	Het
Vmn2r39	C	T	7: 9,023,470		probably null	Het
Vmn2r88	T	A	14: 51,413,245	D138E	probably benign	Het
Vwce	T	C	19: 10,648,467	F448L	possibly damaging	Het
Wdr75	C	T	1: 45,822,485	S695F	probably benign	Het
Zfand4	T	C	6: 116,288,161		probably null	Het
Zfp511	T	A	7: 140,037,511		probably null	Het
Zfyve9	T	C	4: 108,644,368	K584E	possibly damaging	Het

Other mutations in Ift80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Ift80	APN	3	68914653	nonsense	probably null
IGL01020:Ift80	APN	3	68963679	missense	probably damaging	1.00
IGL01544:Ift80	APN	3	68990782	missense	probably benign	0.05
IGL01612:Ift80	APN	3	68963663	missense	possibly damaging	0.61
IGL01743:Ift80	APN	3	68962296	missense	probably benign	0.00
IGL02187:Ift80	APN	3	68985456	missense	probably damaging	1.00
IGL02381:Ift80	APN	3	68962320	splice site	probably null
IGL02407:Ift80	APN	3	68898536	missense	probably benign
IGL02510:Ift80	APN	3	68898543	missense	probably benign	0.07
IGL02512:Ift80	APN	3	68927725	critical splice donor site	probably null
R0091:Ift80	UTSW	3	68914675	missense	probably damaging	1.00
R0212:Ift80	UTSW	3	68940173	missense	probably benign	0.05
R0348:Ift80	UTSW	3	68935899	missense	probably benign
R0357:Ift80	UTSW	3	68914653	nonsense	probably null
R1381:Ift80	UTSW	3	68914783	missense	possibly damaging	0.78
R1419:Ift80	UTSW	3	68940198	missense	probably damaging	1.00
R1643:Ift80	UTSW	3	68916157	missense	probably benign	0.06
R1899:Ift80	UTSW	3	68918513	missense	probably benign	0.00
R1926:Ift80	UTSW	3	68916165	missense	probably damaging	1.00
R2013:Ift80	UTSW	3	68990784	missense	possibly damaging	0.62
R3894:Ift80	UTSW	3	68917999	missense	probably damaging	1.00
R4214:Ift80	UTSW	3	68990808	missense	possibly damaging	0.64
R4290:Ift80	UTSW	3	68963690	missense	probably damaging	0.96
R4303:Ift80	UTSW	3	68894174	missense	probably benign	0.15
R4361:Ift80	UTSW	3	68963649	missense	probably damaging	1.00
R4576:Ift80	UTSW	3	68950530	missense	possibly damaging	0.71
R4596:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4652:Ift80	UTSW	3	68914940	missense	probably benign	0.32
R4654:Ift80	UTSW	3	68918537	missense	possibly damaging	0.94
R4865:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4885:Ift80	UTSW	3	68950496	missense	probably damaging	0.98
R5357:Ift80	UTSW	3	68990780	missense	possibly damaging	0.62
R5561:Ift80	UTSW	3	68967863	missense	probably benign	0.00
R5589:Ift80	UTSW	3	68930900	missense	probably damaging	1.00
R5806:Ift80	UTSW	3	68950476	missense	probably benign	0.09
R6910:Ift80	UTSW	3	68927735	missense	probably benign	0.01
R6962:Ift80	UTSW	3	68994545	start gained	probably benign
R7157:Ift80	UTSW	3	68990944	nonsense	probably null
R7452:Ift80	UTSW	3	68994282	splice site	probably null
R7504:Ift80	UTSW	3	68918005	missense	probably damaging	0.99
R8077:Ift80	UTSW	3	68916145	missense	probably benign	0.01
R8435:Ift80	UTSW	3	68985454	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACATTTCAAAGTGCTCGCTAG -3'
(R):5'- TTCTGAGGCCTGAGAGTTTCC -3'

Sequencing Primer
(F):5'- CATTTCAAAGTGCTCGCTAGGTGAG -3'
(R):5'- CCTGAGAGTTTCCAGGATTATTGC -3'

Posted On

2015-10-21