Mutagenetix > Incidental Mutation

Incidental Mutation 'R4720:Reln'

354364

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

041958-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R4720 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22286896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 113 (F113I)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062372
AA Change: F113I

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: F113I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160707

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161356
AA Change: F113I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: F113I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162427

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162622

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162637

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,127,422	I1124T	probably damaging	Het
Acacb	A	G	5: 114,229,914	T1658A	possibly damaging	Het
Acvrl1	C	A	15: 101,135,773	P112Q	probably damaging	Het
Als2cr12	T	C	1: 58,678,348	I135V	possibly damaging	Het
Ankar	A	T	1: 72,699,011	I4K	possibly damaging	Het
Ankfn1	G	C	11: 89,441,426	D431E	possibly damaging	Het
Apobec4	T	C	1: 152,756,674	V151A	possibly damaging	Het
Atp10b	A	G	11: 43,203,122	S498G	probably benign	Het
Azin1	A	G	15: 38,493,500	V293A	probably benign	Het
Ccdc88b	T	C	19: 6,857,715	E46G	probably damaging	Het
Ccdc96	T	C	5: 36,484,875		probably benign	Het
Ccnyl1	A	G	1: 64,713,131	D169G	probably benign	Het
Cdca3	T	A	6: 124,832,164	V89E	probably damaging	Het
Cdh19	A	T	1: 110,895,381		probably null	Het
Chka	G	A	19: 3,886,375	V238I	probably damaging	Het
Cntn3	T	C	6: 102,242,022	K546E	possibly damaging	Het
Crybg3	A	G	16: 59,539,817	V787A	probably damaging	Het
Dlgap3	T	C	4: 127,195,715		probably null	Het
Dnah8	C	T	17: 30,683,634	L889F	probably benign	Het
Dnah9	T	C	11: 66,076,358	E1658G	probably damaging	Het
Dnajc11	A	G	4: 151,968,539	D102G	probably damaging	Het
Dync1i2	T	G	2: 71,233,674	S121A	probably damaging	Het
Ece1	G	A	4: 137,957,175	E591K	probably damaging	Het
Enthd1	G	A	15: 80,560,309	S15L	probably damaging	Het
Epb41l2	T	A	10: 25,471,626	H372Q	probably damaging	Het
Errfi1	T	A	4: 150,866,747	Y211N	probably damaging	Het
Fam193b	G	A	13: 55,543,437	T208M	probably benign	Het
Fmnl2	C	T	2: 53,107,540	T501M	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm340	G	C	19: 41,585,895	A1030P	probably benign	Het
Gm4841	G	T	18: 60,270,063	D319E	probably benign	Het
Gm5724	C	A	6: 141,723,222	A495S	probably damaging	Het
Gucd1	A	G	10: 75,509,660	F187S	probably damaging	Het
Hcar2	GCGGATGCGCAC	GC	5: 123,864,689		probably null	Het
Helz2	T	C	2: 181,238,417	D502G	probably damaging	Het
Hspa2	A	G	12: 76,404,865	E111G	possibly damaging	Het
Htr2a	T	A	14: 74,645,059	S162T	probably damaging	Het
Ift80	A	G	3: 68,962,290	Y223H	possibly damaging	Het
Il1rl1	A	G	1: 40,446,678	K330E	probably benign	Het
Il23r	A	T	6: 67,423,661	F562I	probably damaging	Het
Isx	T	C	8: 74,873,859		probably null	Het
Jcad	G	A	18: 4,674,055	V606I	probably benign	Het
Kcnn2	A	T	18: 45,683,120	T333S	possibly damaging	Het
Kcnq5	C	T	1: 21,403,050	A630T	probably damaging	Het
Kif2c	T	C	4: 117,171,749	M188V	probably benign	Het
Kntc1	T	C	5: 123,765,023	V321A	possibly damaging	Het
Krtap4-8	A	T	11: 99,780,445		probably benign	Het
Lgals3bp	A	C	11: 118,398,469	L52R	probably damaging	Het
Lipk	C	A	19: 34,021,699	H126Q	probably damaging	Het
Lpgat1	T	C	1: 191,763,667	Y323H	probably damaging	Het
Lrp2	T	G	2: 69,481,173	N2654H	probably damaging	Het
Lsm14b	C	T	2: 180,027,981	Q6*	probably null	Het
Lysmd3	C	T	13: 81,669,465	A187V	possibly damaging	Het
Map2k5	A	G	9: 63,293,719	S211P	probably damaging	Het
Mlph	A	T	1: 90,941,697	I474F	probably damaging	Het
Mpped2	T	C	2: 106,783,746	S142P	probably damaging	Het
Nemf	A	C	12: 69,324,288	M678R	probably benign	Het
Nfe2l1	A	T	11: 96,827,689	Y7N	probably damaging	Het
Nfkbie	T	G	17: 45,556,306	D122E	probably benign	Het
Noc3l	C	A	19: 38,789,622	A783S	probably benign	Het
Nol8	T	C	13: 49,662,753	V761A	probably damaging	Het
Nvl	A	G	1: 181,101,587	L743P	probably damaging	Het
Olfr3	T	A	2: 36,812,472	I207F	probably benign	Het
Plcb1	A	G	2: 135,251,747	K160R	possibly damaging	Het
Plekhg3	G	T	12: 76,578,322	G1313C	possibly damaging	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Popdc3	G	A	10: 45,314,906	V38I	probably benign	Het
Prdx3	A	T	19: 60,870,113	V114D	possibly damaging	Het
Prkdc	T	A	16: 15,667,715	S469T	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Rims1	A	G	1: 22,427,481	Y808H	probably damaging	Het
Rsbn1	C	A	3: 103,929,020	T458N	possibly damaging	Het
Serpina3b	A	G	12: 104,130,630	S57G	possibly damaging	Het
Skor2	G	T	18: 76,861,183		probably null	Het
Slc22a4	A	T	11: 53,988,893	Y447N	probably damaging	Het
Stx19	G	T	16: 62,822,319	R166L	probably damaging	Het
Svep1	T	C	4: 58,205,869	T170A	possibly damaging	Het
Sycp2	T	G	2: 178,374,432	S746R	probably benign	Het
Tchh	G	T	3: 93,447,882	R1543L	unknown	Het
Tjp2	T	C	19: 24,100,805	D908G	probably damaging	Het
Ttc8	C	A	12: 98,979,809	A452E	possibly damaging	Het
Unc5a	T	A	13: 55,003,883	W709R	probably null	Het
Unc80	T	A	1: 66,510,792	S736R	possibly damaging	Het
Vmn2r100	C	A	17: 19,522,526	H387Q	probably benign	Het
Vmn2r39	C	T	7: 9,023,470		probably null	Het
Vmn2r88	T	A	14: 51,413,245	D138E	probably benign	Het
Vwce	T	C	19: 10,648,467	F448L	possibly damaging	Het
Wdr75	C	T	1: 45,822,485	S695F	probably benign	Het
Zfand4	T	C	6: 116,288,161		probably null	Het
Zfp511	T	A	7: 140,037,511		probably null	Het
Zfyve9	T	C	4: 108,644,368	K584E	possibly damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
Fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21920496	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4721:Reln	UTSW	5	21919222	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22039529	missense	probably benign
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21899113	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6932:Reln	UTSW	5	21985857	missense	probably benign	0.00
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21915087	nonsense	probably null
R7091:Reln	UTSW	5	21899029	missense	probably null	0.08
R7135:Reln	UTSW	5	21976596	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22106097	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21942620	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22047947	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21978923	missense	probably benign	0.03
R7393:Reln	UTSW	5	21976351	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22051367	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21971934	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21971953	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22103435	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21942741	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21929127	missense	probably benign	0.25
R7501:Reln	UTSW	5	22227638	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21976278	nonsense	probably null
R7588:Reln	UTSW	5	21885568	missense	probably benign	0.03
R7631:Reln	UTSW	5	21971935	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21978931	missense	probably benign	0.39
R7834:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22134692	missense	probably benign	0.00
R7938:Reln	UTSW	5	21950872	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21899084	nonsense	probably null
R8062:Reln	UTSW	5	21971992	missense	probably benign	0.00
R8222:Reln	UTSW	5	21931477	nonsense	probably null
R8266:Reln	UTSW	5	22018087	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22004112	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21899029	missense	probably benign	0.03
R8523:Reln	UTSW	5	22004231	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21942674	missense	probably benign	0.37
R8801:Reln	UTSW	5	21950856	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21925259	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21885514	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21899157	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21979579	missense	probably benign	0.00
R9022:Reln	UTSW	5	21976615	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22048038	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22011061	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21925200	missense	probably benign	0.01
R9126:Reln	UTSW	5	21955196	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21950817	critical splice donor site	probably null
R9182:Reln	UTSW	5	21901619	missense	probably benign	0.44
R9196:Reln	UTSW	5	22152473	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22344202	nonsense	probably null
R9241:Reln	UTSW	5	21969069	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21915153	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21948547	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22004211	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21988707	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22080691	missense	probably benign	0.01
R9309:Reln	UTSW	5	21971868	missense	probably benign	0.37
R9338:Reln	UTSW	5	21997939	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22344204	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21915107	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22344200	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21920510	missense	possibly damaging	0.46
Z1176:Reln	UTSW	5	21979024	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	21969241	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22004082	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22154959	missense	probably benign	0.05
Z1177:Reln	UTSW	5	22227636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTCCCAAGACCATGGTTAGC -3'
(R):5'- ACCTAAGACTCCAGAGTGTACC -3'

Sequencing Primer
(F):5'- GACCATGGTTAGCTGAGCATTTACAC -3'
(R):5'- TAAGACTCCAGAGTGTACCTGCTC -3'

Posted On

2015-10-21