Mutagenetix > Incidental Mutation

Incidental Mutation 'R4720:Acacb'

354366

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

041958-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4720 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114229914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1658 (T1658A)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: T1658A

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: T1658A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: T1658A

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: T1658A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,127,422	I1124T	probably damaging	Het
Acvrl1	C	A	15: 101,135,773	P112Q	probably damaging	Het
Als2cr12	T	C	1: 58,678,348	I135V	possibly damaging	Het
Ankar	A	T	1: 72,699,011	I4K	possibly damaging	Het
Ankfn1	G	C	11: 89,441,426	D431E	possibly damaging	Het
Apobec4	T	C	1: 152,756,674	V151A	possibly damaging	Het
Atp10b	A	G	11: 43,203,122	S498G	probably benign	Het
Azin1	A	G	15: 38,493,500	V293A	probably benign	Het
Ccdc88b	T	C	19: 6,857,715	E46G	probably damaging	Het
Ccdc96	T	C	5: 36,484,875		probably benign	Het
Ccnyl1	A	G	1: 64,713,131	D169G	probably benign	Het
Cdca3	T	A	6: 124,832,164	V89E	probably damaging	Het
Cdh19	A	T	1: 110,895,381		probably null	Het
Chka	G	A	19: 3,886,375	V238I	probably damaging	Het
Cntn3	T	C	6: 102,242,022	K546E	possibly damaging	Het
Crybg3	A	G	16: 59,539,817	V787A	probably damaging	Het
Dlgap3	T	C	4: 127,195,715		probably null	Het
Dnah8	C	T	17: 30,683,634	L889F	probably benign	Het
Dnah9	T	C	11: 66,076,358	E1658G	probably damaging	Het
Dnajc11	A	G	4: 151,968,539	D102G	probably damaging	Het
Dync1i2	T	G	2: 71,233,674	S121A	probably damaging	Het
Ece1	G	A	4: 137,957,175	E591K	probably damaging	Het
Enthd1	G	A	15: 80,560,309	S15L	probably damaging	Het
Epb41l2	T	A	10: 25,471,626	H372Q	probably damaging	Het
Errfi1	T	A	4: 150,866,747	Y211N	probably damaging	Het
Fam193b	G	A	13: 55,543,437	T208M	probably benign	Het
Fmnl2	C	T	2: 53,107,540	T501M	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm340	G	C	19: 41,585,895	A1030P	probably benign	Het
Gm4841	G	T	18: 60,270,063	D319E	probably benign	Het
Gm5724	C	A	6: 141,723,222	A495S	probably damaging	Het
Gucd1	A	G	10: 75,509,660	F187S	probably damaging	Het
Hcar2	GCGGATGCGCAC	GC	5: 123,864,689		probably null	Het
Helz2	T	C	2: 181,238,417	D502G	probably damaging	Het
Hspa2	A	G	12: 76,404,865	E111G	possibly damaging	Het
Htr2a	T	A	14: 74,645,059	S162T	probably damaging	Het
Ift80	A	G	3: 68,962,290	Y223H	possibly damaging	Het
Il1rl1	A	G	1: 40,446,678	K330E	probably benign	Het
Il23r	A	T	6: 67,423,661	F562I	probably damaging	Het
Isx	T	C	8: 74,873,859		probably null	Het
Jcad	G	A	18: 4,674,055	V606I	probably benign	Het
Kcnn2	A	T	18: 45,683,120	T333S	possibly damaging	Het
Kcnq5	C	T	1: 21,403,050	A630T	probably damaging	Het
Kif2c	T	C	4: 117,171,749	M188V	probably benign	Het
Kntc1	T	C	5: 123,765,023	V321A	possibly damaging	Het
Krtap4-8	A	T	11: 99,780,445		probably benign	Het
Lgals3bp	A	C	11: 118,398,469	L52R	probably damaging	Het
Lipk	C	A	19: 34,021,699	H126Q	probably damaging	Het
Lpgat1	T	C	1: 191,763,667	Y323H	probably damaging	Het
Lrp2	T	G	2: 69,481,173	N2654H	probably damaging	Het
Lsm14b	C	T	2: 180,027,981	Q6*	probably null	Het
Lysmd3	C	T	13: 81,669,465	A187V	possibly damaging	Het
Map2k5	A	G	9: 63,293,719	S211P	probably damaging	Het
Mlph	A	T	1: 90,941,697	I474F	probably damaging	Het
Mpped2	T	C	2: 106,783,746	S142P	probably damaging	Het
Nemf	A	C	12: 69,324,288	M678R	probably benign	Het
Nfe2l1	A	T	11: 96,827,689	Y7N	probably damaging	Het
Nfkbie	T	G	17: 45,556,306	D122E	probably benign	Het
Noc3l	C	A	19: 38,789,622	A783S	probably benign	Het
Nol8	T	C	13: 49,662,753	V761A	probably damaging	Het
Nvl	A	G	1: 181,101,587	L743P	probably damaging	Het
Olfr3	T	A	2: 36,812,472	I207F	probably benign	Het
Plcb1	A	G	2: 135,251,747	K160R	possibly damaging	Het
Plekhg3	G	T	12: 76,578,322	G1313C	possibly damaging	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Popdc3	G	A	10: 45,314,906	V38I	probably benign	Het
Prdx3	A	T	19: 60,870,113	V114D	possibly damaging	Het
Prkdc	T	A	16: 15,667,715	S469T	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Reln	A	T	5: 22,286,896	F113I	possibly damaging	Het
Rims1	A	G	1: 22,427,481	Y808H	probably damaging	Het
Rsbn1	C	A	3: 103,929,020	T458N	possibly damaging	Het
Serpina3b	A	G	12: 104,130,630	S57G	possibly damaging	Het
Skor2	G	T	18: 76,861,183		probably null	Het
Slc22a4	A	T	11: 53,988,893	Y447N	probably damaging	Het
Stx19	G	T	16: 62,822,319	R166L	probably damaging	Het
Svep1	T	C	4: 58,205,869	T170A	possibly damaging	Het
Sycp2	T	G	2: 178,374,432	S746R	probably benign	Het
Tchh	G	T	3: 93,447,882	R1543L	unknown	Het
Tjp2	T	C	19: 24,100,805	D908G	probably damaging	Het
Ttc8	C	A	12: 98,979,809	A452E	possibly damaging	Het
Unc5a	T	A	13: 55,003,883	W709R	probably null	Het
Unc80	T	A	1: 66,510,792	S736R	possibly damaging	Het
Vmn2r100	C	A	17: 19,522,526	H387Q	probably benign	Het
Vmn2r39	C	T	7: 9,023,470		probably null	Het
Vmn2r88	T	A	14: 51,413,245	D138E	probably benign	Het
Vwce	T	C	19: 10,648,467	F448L	possibly damaging	Het
Wdr75	C	T	1: 45,822,485	S695F	probably benign	Het
Zfand4	T	C	6: 116,288,161		probably null	Het
Zfp511	T	A	7: 140,037,511		probably null	Het
Zfyve9	T	C	4: 108,644,368	K584E	possibly damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGACATGGTCATGCGCTATG -3'
(R):5'- GGTTAATGGCCACACACTCCAC -3'

Sequencing Primer
(F):5'- ATGGCAGCCGTCTGTGGAAG -3'
(R):5'- CAGGATGGACTCTGCCAAG -3'

Posted On

2015-10-21