Incidental Mutation 'R4720:Acacb'
ID 354366
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 041958-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4720 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114367975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1658 (T1658A)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect possibly damaging
Transcript: ENSMUST00000031583
AA Change: T1658A

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: T1658A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102582
AA Change: T1658A

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: T1658A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,018,248 (GRCm39) I1124T probably damaging Het
Acvrl1 C A 15: 101,033,654 (GRCm39) P112Q probably damaging Het
Ankar A T 1: 72,738,170 (GRCm39) I4K possibly damaging Het
Ankfn1 G C 11: 89,332,252 (GRCm39) D431E possibly damaging Het
Apobec4 T C 1: 152,632,425 (GRCm39) V151A possibly damaging Het
Atp10b A G 11: 43,093,949 (GRCm39) S498G probably benign Het
Azin1 A G 15: 38,493,744 (GRCm39) V293A probably benign Het
Ccdc88b T C 19: 6,835,083 (GRCm39) E46G probably damaging Het
Ccdc96 T C 5: 36,642,219 (GRCm39) probably benign Het
Ccnyl1 A G 1: 64,752,290 (GRCm39) D169G probably benign Het
Cdca3 T A 6: 124,809,127 (GRCm39) V89E probably damaging Het
Cdh19 A T 1: 110,823,111 (GRCm39) probably null Het
Chka G A 19: 3,936,375 (GRCm39) V238I probably damaging Het
Cntn3 T C 6: 102,218,983 (GRCm39) K546E possibly damaging Het
Crybg3 A G 16: 59,360,180 (GRCm39) V787A probably damaging Het
Dlgap3 T C 4: 127,089,508 (GRCm39) probably null Het
Dnah8 C T 17: 30,902,608 (GRCm39) L889F probably benign Het
Dnah9 T C 11: 65,967,184 (GRCm39) E1658G probably damaging Het
Dnajc11 A G 4: 152,052,996 (GRCm39) D102G probably damaging Het
Dync1i2 T G 2: 71,064,018 (GRCm39) S121A probably damaging Het
Ece1 G A 4: 137,684,486 (GRCm39) E591K probably damaging Het
Enthd1 G A 15: 80,444,510 (GRCm39) S15L probably damaging Het
Epb41l2 T A 10: 25,347,524 (GRCm39) H372Q probably damaging Het
Errfi1 T A 4: 150,951,204 (GRCm39) Y211N probably damaging Het
Fam193b G A 13: 55,691,250 (GRCm39) T208M probably benign Het
Flacc1 T C 1: 58,717,507 (GRCm39) I135V possibly damaging Het
Fmnl2 C T 2: 52,997,552 (GRCm39) T501M possibly damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm4841 G T 18: 60,403,135 (GRCm39) D319E probably benign Het
Gucd1 A G 10: 75,345,494 (GRCm39) F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 124,002,752 (GRCm39) probably null Het
Helz2 T C 2: 180,880,210 (GRCm39) D502G probably damaging Het
Hspa2 A G 12: 76,451,639 (GRCm39) E111G possibly damaging Het
Htr2a T A 14: 74,882,499 (GRCm39) S162T probably damaging Het
Ift80 A G 3: 68,869,623 (GRCm39) Y223H possibly damaging Het
Il1rl1 A G 1: 40,485,838 (GRCm39) K330E probably benign Het
Il23r A T 6: 67,400,645 (GRCm39) F562I probably damaging Het
Isx T C 8: 75,600,487 (GRCm39) probably null Het
Jcad G A 18: 4,674,055 (GRCm39) V606I probably benign Het
Kcnn2 A T 18: 45,816,187 (GRCm39) T333S possibly damaging Het
Kcnq5 C T 1: 21,473,274 (GRCm39) A630T probably damaging Het
Kif2c T C 4: 117,028,946 (GRCm39) M188V probably benign Het
Kntc1 T C 5: 123,903,086 (GRCm39) V321A possibly damaging Het
Krtap4-8 A T 11: 99,671,271 (GRCm39) probably benign Het
Lcor G C 19: 41,574,334 (GRCm39) A1030P probably benign Het
Lgals3bp A C 11: 118,289,295 (GRCm39) L52R probably damaging Het
Lipk C A 19: 33,999,099 (GRCm39) H126Q probably damaging Het
Lpgat1 T C 1: 191,495,779 (GRCm39) Y323H probably damaging Het
Lrp2 T G 2: 69,311,517 (GRCm39) N2654H probably damaging Het
Lsm14b C T 2: 179,669,774 (GRCm39) Q6* probably null Het
Lysmd3 C T 13: 81,817,584 (GRCm39) A187V possibly damaging Het
Map2k5 A G 9: 63,201,001 (GRCm39) S211P probably damaging Het
Mlph A T 1: 90,869,419 (GRCm39) I474F probably damaging Het
Mpped2 T C 2: 106,614,091 (GRCm39) S142P probably damaging Het
Nemf A C 12: 69,371,062 (GRCm39) M678R probably benign Het
Nfe2l1 A T 11: 96,718,515 (GRCm39) Y7N probably damaging Het
Nfkbie T G 17: 45,867,232 (GRCm39) D122E probably benign Het
Noc3l C A 19: 38,778,066 (GRCm39) A783S probably benign Het
Nol8 T C 13: 49,816,229 (GRCm39) V761A probably damaging Het
Nvl A G 1: 180,929,152 (GRCm39) L743P probably damaging Het
Or1j1 T A 2: 36,702,484 (GRCm39) I207F probably benign Het
Plcb1 A G 2: 135,093,667 (GRCm39) K160R possibly damaging Het
Plekhg3 G T 12: 76,625,096 (GRCm39) G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,122,194 (GRCm39) probably null Het
Popdc3 G A 10: 45,191,002 (GRCm39) V38I probably benign Het
Prdx3 A T 19: 60,858,551 (GRCm39) V114D possibly damaging Het
Prkdc T A 16: 15,485,579 (GRCm39) S469T probably benign Het
Rbm22 G A 18: 60,697,463 (GRCm39) R56H probably damaging Het
Reln A T 5: 22,491,894 (GRCm39) F113I possibly damaging Het
Rims1 A G 1: 22,497,731 (GRCm39) Y808H probably damaging Het
Rsbn1 C A 3: 103,836,336 (GRCm39) T458N possibly damaging Het
Serpina3b A G 12: 104,096,889 (GRCm39) S57G possibly damaging Het
Skor2 G T 18: 76,948,878 (GRCm39) probably null Het
Slc22a4 A T 11: 53,879,719 (GRCm39) Y447N probably damaging Het
Slco1a7 C A 6: 141,668,948 (GRCm39) A495S probably damaging Het
Stx19 G T 16: 62,642,682 (GRCm39) R166L probably damaging Het
Svep1 T C 4: 58,205,869 (GRCm39) T170A possibly damaging Het
Sycp2 T G 2: 178,016,225 (GRCm39) S746R probably benign Het
Tchh G T 3: 93,355,189 (GRCm39) R1543L unknown Het
Tjp2 T C 19: 24,078,169 (GRCm39) D908G probably damaging Het
Ttc8 C A 12: 98,946,068 (GRCm39) A452E possibly damaging Het
Unc5a T A 13: 55,151,696 (GRCm39) W709R probably null Het
Unc80 T A 1: 66,549,951 (GRCm39) S736R possibly damaging Het
Vmn2r100 C A 17: 19,742,788 (GRCm39) H387Q probably benign Het
Vmn2r39 C T 7: 9,026,469 (GRCm39) probably null Het
Vmn2r88 T A 14: 51,650,702 (GRCm39) D138E probably benign Het
Vwce T C 19: 10,625,831 (GRCm39) F448L possibly damaging Het
Wdr75 C T 1: 45,861,645 (GRCm39) S695F probably benign Het
Zfand4 T C 6: 116,265,122 (GRCm39) probably null Het
Zfp511 T A 7: 139,617,424 (GRCm39) probably null Het
Zfyve9 T C 4: 108,501,565 (GRCm39) K584E possibly damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACATGGTCATGCGCTATG -3'
(R):5'- GGTTAATGGCCACACACTCCAC -3'

Sequencing Primer
(F):5'- ATGGCAGCCGTCTGTGGAAG -3'
(R):5'- CAGGATGGACTCTGCCAAG -3'
Posted On 2015-10-21