Mutagenetix > Incidental Mutations

Incidental Mutation 'R4720:Map2k5'

354380

Institutional Source

Beutler Lab

Gene Symbol

Map2k5

Ensembl Gene

ENSMUSG00000058444

Gene Name

mitogen-activated protein kinase kinase 5

Synonyms

MEK5

MMRRC Submission

041958-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4720 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63163768-63377902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63293719 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 211 (S211P)

Ref Sequence

ENSEMBL: ENSMUSP00000034920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034920]

PDB Structure

Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034920
AA Change: S211P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: S211P

Domain	Start	End	E-Value	Type
PB1	18	97	7.59e-12	SMART
S_TKc	166	419	7.75e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213604

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,127,422	I1124T	probably damaging	Het
Acacb	A	G	5: 114,229,914	T1658A	possibly damaging	Het
Acvrl1	C	A	15: 101,135,773	P112Q	probably damaging	Het
Als2cr12	T	C	1: 58,678,348	I135V	possibly damaging	Het
Ankar	A	T	1: 72,699,011	I4K	possibly damaging	Het
Ankfn1	G	C	11: 89,441,426	D431E	possibly damaging	Het
Apobec4	T	C	1: 152,756,674	V151A	possibly damaging	Het
Atp10b	A	G	11: 43,203,122	S498G	probably benign	Het
Azin1	A	G	15: 38,493,500	V293A	probably benign	Het
Ccdc88b	T	C	19: 6,857,715	E46G	probably damaging	Het
Ccdc96	T	C	5: 36,484,875		probably benign	Het
Ccnyl1	A	G	1: 64,713,131	D169G	probably benign	Het
Cdca3	T	A	6: 124,832,164	V89E	probably damaging	Het
Cdh19	A	T	1: 110,895,381		probably null	Het
Chka	G	A	19: 3,886,375	V238I	probably damaging	Het
Cntn3	T	C	6: 102,242,022	K546E	possibly damaging	Het
Crybg3	A	G	16: 59,539,817	V787A	probably damaging	Het
Dlgap3	T	C	4: 127,195,715		probably null	Het
Dnah8	C	T	17: 30,683,634	L889F	probably benign	Het
Dnah9	T	C	11: 66,076,358	E1658G	probably damaging	Het
Dnajc11	A	G	4: 151,968,539	D102G	probably damaging	Het
Dync1i2	T	G	2: 71,233,674	S121A	probably damaging	Het
Ece1	G	A	4: 137,957,175	E591K	probably damaging	Het
Enthd1	G	A	15: 80,560,309	S15L	probably damaging	Het
Epb41l2	T	A	10: 25,471,626	H372Q	probably damaging	Het
Errfi1	T	A	4: 150,866,747	Y211N	probably damaging	Het
Fam193b	G	A	13: 55,543,437	T208M	probably benign	Het
Fmnl2	C	T	2: 53,107,540	T501M	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm340	G	C	19: 41,585,895	A1030P	probably benign	Het
Gm4841	G	T	18: 60,270,063	D319E	probably benign	Het
Gm5724	C	A	6: 141,723,222	A495S	probably damaging	Het
Gucd1	A	G	10: 75,509,660	F187S	probably damaging	Het
Hcar2	GCGGATGCGCAC	GC	5: 123,864,689		probably null	Het
Helz2	T	C	2: 181,238,417	D502G	probably damaging	Het
Hspa2	A	G	12: 76,404,865	E111G	possibly damaging	Het
Htr2a	T	A	14: 74,645,059	S162T	probably damaging	Het
Ift80	A	G	3: 68,962,290	Y223H	possibly damaging	Het
Il1rl1	A	G	1: 40,446,678	K330E	probably benign	Het
Il23r	A	T	6: 67,423,661	F562I	probably damaging	Het
Isx	T	C	8: 74,873,859		probably null	Het
Jcad	G	A	18: 4,674,055	V606I	probably benign	Het
Kcnn2	A	T	18: 45,683,120	T333S	possibly damaging	Het
Kcnq5	C	T	1: 21,403,050	A630T	probably damaging	Het
Kif2c	T	C	4: 117,171,749	M188V	probably benign	Het
Kntc1	T	C	5: 123,765,023	V321A	possibly damaging	Het
Krtap4-8	A	T	11: 99,780,445		probably benign	Het
Lgals3bp	A	C	11: 118,398,469	L52R	probably damaging	Het
Lipk	C	A	19: 34,021,699	H126Q	probably damaging	Het
Lpgat1	T	C	1: 191,763,667	Y323H	probably damaging	Het
Lrp2	T	G	2: 69,481,173	N2654H	probably damaging	Het
Lsm14b	C	T	2: 180,027,981	Q6*	probably null	Het
Lysmd3	C	T	13: 81,669,465	A187V	possibly damaging	Het
Mlph	A	T	1: 90,941,697	I474F	probably damaging	Het
Mpped2	T	C	2: 106,783,746	S142P	probably damaging	Het
Nemf	A	C	12: 69,324,288	M678R	probably benign	Het
Nfe2l1	A	T	11: 96,827,689	Y7N	probably damaging	Het
Nfkbie	T	G	17: 45,556,306	D122E	probably benign	Het
Noc3l	C	A	19: 38,789,622	A783S	probably benign	Het
Nol8	T	C	13: 49,662,753	V761A	probably damaging	Het
Nvl	A	G	1: 181,101,587	L743P	probably damaging	Het
Olfr3	T	A	2: 36,812,472	I207F	probably benign	Het
Plcb1	A	G	2: 135,251,747	K160R	possibly damaging	Het
Plekhg3	G	T	12: 76,578,322	G1313C	possibly damaging	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Popdc3	G	A	10: 45,314,906	V38I	probably benign	Het
Prdx3	A	T	19: 60,870,113	V114D	possibly damaging	Het
Prkdc	T	A	16: 15,667,715	S469T	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Reln	A	T	5: 22,286,896	F113I	possibly damaging	Het
Rims1	A	G	1: 22,427,481	Y808H	probably damaging	Het
Rsbn1	C	A	3: 103,929,020	T458N	possibly damaging	Het
Serpina3b	A	G	12: 104,130,630	S57G	possibly damaging	Het
Skor2	G	T	18: 76,861,183		probably null	Het
Slc22a4	A	T	11: 53,988,893	Y447N	probably damaging	Het
Stx19	G	T	16: 62,822,319	R166L	probably damaging	Het
Svep1	T	C	4: 58,205,869	T170A	possibly damaging	Het
Sycp2	T	G	2: 178,374,432	S746R	probably benign	Het
Tchh	G	T	3: 93,447,882	R1543L	unknown	Het
Tjp2	T	C	19: 24,100,805	D908G	probably damaging	Het
Ttc8	C	A	12: 98,979,809	A452E	possibly damaging	Het
Unc5a	T	A	13: 55,003,883	W709R	probably null	Het
Unc80	T	A	1: 66,510,792	S736R	possibly damaging	Het
Vmn2r100	C	A	17: 19,522,526	H387Q	probably benign	Het
Vmn2r39	C	T	7: 9,023,470		probably null	Het
Vmn2r88	T	A	14: 51,413,245	D138E	probably benign	Het
Vwce	T	C	19: 10,648,467	F448L	possibly damaging	Het
Wdr75	C	T	1: 45,822,485	S695F	probably benign	Het
Zfand4	T	C	6: 116,288,161		probably null	Het
Zfp511	T	A	7: 140,037,511		probably null	Het
Zfyve9	T	C	4: 108,644,368	K584E	possibly damaging	Het

Other mutations in Map2k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Map2k5	APN	9	63281077	splice site	probably benign
IGL01412:Map2k5	APN	9	63293706	missense	probably damaging	1.00
IGL01766:Map2k5	APN	9	63377227	missense	probably benign
IGL02246:Map2k5	APN	9	63377129	missense	probably benign	0.10
IGL02270:Map2k5	APN	9	63322197	splice site	probably null
IGL02793:Map2k5	APN	9	63257039	missense	probably benign	0.32
IGL03236:Map2k5	APN	9	63286392	splice site	probably benign
R0007:Map2k5	UTSW	9	63293724	missense	probably damaging	1.00
R0217:Map2k5	UTSW	9	63256975	critical splice donor site	probably null
R0315:Map2k5	UTSW	9	63303151	missense	probably damaging	1.00
R0801:Map2k5	UTSW	9	63357979	splice site	probably benign
R1122:Map2k5	UTSW	9	63263163	missense	probably damaging	1.00
R1822:Map2k5	UTSW	9	63235303	missense	possibly damaging	0.79
R4308:Map2k5	UTSW	9	63235304	missense	probably benign	0.02
R4421:Map2k5	UTSW	9	63164130	missense	probably damaging	0.96
R4869:Map2k5	UTSW	9	63322243	nonsense	probably null
R5059:Map2k5	UTSW	9	63257014	missense	probably benign	0.41
R5138:Map2k5	UTSW	9	63263158	missense	probably damaging	0.99
R6005:Map2k5	UTSW	9	63281019	missense	probably damaging	1.00
R6258:Map2k5	UTSW	9	63217365	missense	probably benign	0.16
R6261:Map2k5	UTSW	9	63338098	missense	probably benign	0.00
R6498:Map2k5	UTSW	9	63286401	missense	possibly damaging	0.74
R6808:Map2k5	UTSW	9	63322246	missense	probably benign	0.00
R7228:Map2k5	UTSW	9	63358022	missense	probably damaging	1.00
R7819:Map2k5	UTSW	9	63358018	missense	probably damaging	0.99
R8053:Map2k5	UTSW	9	63343425	missense	probably benign	0.16
Z1176:Map2k5	UTSW	9	63358038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTCACCATCCATGAATTCTGTAC -3'
(R):5'- GGCTTAGCTTCAGAGACAGC -3'

Sequencing Primer
(F):5'- CCATCCATGAATTCTGTACAAATTG -3'
(R):5'- GTATCTCACGTGCTATGTAAC -3'

Posted On

2015-10-21