Incidental Mutation 'R4720:Abca9'
ID354390
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
MMRRC Submission 041958-MU
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110127422 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1124 (I1124T)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect probably damaging
Transcript: ENSMUST00000044850
AA Change: I1124T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: I1124T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4411:Abca9 UTSW 11 110151955 missense probably benign 0.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5350:Abca9 UTSW 11 110115538 missense probably benign
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5872:Abca9 UTSW 11 110117076 missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6481:Abca9 UTSW 11 110165962 nonsense probably null
R6675:Abca9 UTSW 11 110115476 missense probably benign
R6909:Abca9 UTSW 11 110115497 missense probably benign 0.01
R7390:Abca9 UTSW 11 110145661 missense probably benign 0.01
R7429:Abca9 UTSW 11 110127426 frame shift probably null
R7431:Abca9 UTSW 11 110127426 frame shift probably null
R7621:Abca9 UTSW 11 110160533 missense probably benign 0.00
R7623:Abca9 UTSW 11 110107558 missense probably benign 0.27
R7660:Abca9 UTSW 11 110115452 missense probably benign
R7784:Abca9 UTSW 11 110154417 nonsense probably null
R7798:Abca9 UTSW 11 110138179 missense probably benign 0.45
R7839:Abca9 UTSW 11 110134259 missense probably benign 0.43
R7891:Abca9 UTSW 11 110163272 missense probably benign 0.03
R7894:Abca9 UTSW 11 110106589 missense possibly damaging 0.49
R8030:Abca9 UTSW 11 110120708 missense probably benign
R8133:Abca9 UTSW 11 110127463 missense possibly damaging 0.88
R8195:Abca9 UTSW 11 110138329 missense probably benign 0.01
R8304:Abca9 UTSW 11 110107128 critical splice donor site probably null
R8386:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R8390:Abca9 UTSW 11 110145630 missense probably benign 0.01
Z1176:Abca9 UTSW 11 110135375 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCATTCTGCTTAGTACAATGGT -3'
(R):5'- GTGGGTGGGGAAGCATCTTA -3'

Sequencing Primer
(F):5'- TCAGCATTTAAGAGCCCGTG -3'
(R):5'- TGGGGAAGCATCTTAGAGGC -3'
Posted On2015-10-21